GEO help: Mouse over screen elements for information.
Status
Public on Nov 12, 2010
Title
Agilent-026655 Whole Mouse Genome Microarray 4x44K v2 (Probe Name version)
Technology type
in situ oligonucleotide
Distribution
commercial
Organism
Mus musculus Manufacturer
Agilent Technologies
Manufacture protocol
see manufacturer's web site at http://www.agilent.com/
Description
*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL10333.
Submission date
Nov 12, 2010
Last update date
Nov 01, 2017
Organization
Agilent Technologies
E-mail(s)
[email protected] Phone
877-424-4536
URL
http://www.agilent.com Department
Street address
City
Palo Alto
State/province
CA
ZIP/Postal code
94304
Country
USA
Samples (4172)
GSM622301 , GSM622302 , GSM622303 , GSM769572 , GSM769573 , GSM769574
GSM769575 ,
GSM769576 ,
GSM769577 ,
GSM779123 ,
GSM779124 ,
GSM815623 ,
GSM815624 ,
GSM815625 ,
GSM815626 ,
GSM815627 ,
GSM815628 ,
GSM815629 ,
GSM815630 ,
GSM818510 ,
GSM818511 ,
GSM818512 ,
GSM818513 ,
GSM818514 ,
GSM818515 ,
GSM818516 ,
GSM818517 ,
GSM818518 ,
GSM818519 ,
GSM818520 ,
GSM818521 ,
GSM818522 ,
GSM818523 ,
GSM818524 ,
GSM818525 ,
GSM818526 ,
GSM818527 ,
GSM818528 ,
GSM818529 ,
GSM818530 ,
GSM818531 ,
GSM818532 ,
GSM818533 ,
GSM818534 ,
GSM818535 ,
GSM818536 ,
GSM818537 ,
GSM818538 ,
GSM818539 ,
GSM818540 ,
GSM818541 ,
GSM818542 ,
GSM818543 ,
GSM830131 ,
GSM830132 ,
GSM830133 ,
GSM830134 ,
GSM830135 ,
GSM830136 ,
GSM830137 ,
GSM830138 ,
GSM833350 ,
GSM833351 ,
GSM833352 ,
GSM833353 ,
GSM833354 ,
GSM833355 ,
GSM833356 ,
GSM833357 ,
GSM854759 ,
GSM854760 ,
GSM854761 ,
GSM854762 ,
GSM854763 ,
GSM854764 ,
GSM854765 ,
GSM854766 ,
GSM854767 ,
GSM854768 ,
GSM854769 ,
GSM854770 ,
GSM854771 ,
GSM854772 ,
GSM854773 ,
GSM854774 ,
GSM854775 ,
GSM854776 ,
GSM854777 ,
GSM854778 ,
GSM854779 ,
GSM862323 ,
GSM862324 ,
GSM862325 ,
GSM862326 ,
GSM862327 ,
GSM862328 ,
GSM862329 ,
GSM862330 ,
GSM862331 ,
GSM862332 ,
GSM862333 ,
GSM862334 ,
GSM862437 ,
GSM862438 ,
GSM862439 ,
GSM862440 ,
GSM864795 ,
GSM864796 ,
GSM864797 ,
GSM864798 ,
GSM870527 ,
GSM870528 ,
GSM870529 ,
GSM870530 ,
GSM880657 ,
GSM880658 ,
GSM880659 ,
GSM880660 ,
GSM880661 ,
GSM880662 ,
GSM880663 ,
GSM880664 ,
GSM880665 ,
GSM880666 ,
GSM880667 ,
GSM880668 ,
GSM897419 ,
GSM897420 ,
GSM897421 ,
GSM897422 ,
GSM897423 ,
GSM897424 ,
GSM897425 ,
GSM897426 ,
GSM897427 ,
GSM897428 ,
GSM897429 ,
GSM897430 ,
GSM897431 ,
GSM897432 ,
GSM897433 ,
GSM898994 ,
GSM898995 ,
GSM898996 ,
GSM898997 ,
GSM898998 ,
GSM898999 ,
GSM902290 ,
GSM902291 ,
GSM902292 ,
GSM902293 ,
GSM902294 ,
GSM902295 ,
GSM902296 ,
GSM902297 ,
GSM902298 ,
GSM902299 ,
GSM902300 ,
GSM902301 ,
GSM922307 ,
GSM922308 ,
GSM922309 ,
GSM922310 ,
GSM922311 ,
GSM922312 ,
GSM922313 ,
GSM922314 ,
GSM922316 ,
GSM922317 ,
GSM922318 ,
GSM922319 ,
GSM922320 ,
GSM922321 ,
GSM922322 ,
GSM922323 ,
GSM922324 ,
GSM922325 ,
GSM922326 ,
GSM922327 ,
GSM927332 ,
GSM927333 ,
GSM927334 ,
GSM927335 ,
GSM927336 ,
GSM927337 ,
GSM934557 ,
GSM934558 ,
GSM934559 ,
GSM934560 ,
GSM934561 ,
GSM934562 ,
GSM934563 ,
GSM934564 ,
GSM934565 ,
GSM934566 ,
GSM934567 ,
GSM934568 ,
GSM934569 ,
GSM934570 ,
GSM934571 ,
GSM945860 ,
GSM946926 ,
GSM946935 ,
GSM946936 ,
GSM949319 ,
GSM949320 ,
GSM960111 ,
GSM960112 ,
GSM1015179 ,
GSM1015180 ,
GSM1015181 ,
GSM1015182 ,
GSM1015183 ,
GSM1015184 ,
GSM1015185 ,
GSM1015186 ,
GSM1015187 ,
GSM1015188 ,
GSM1015189 ,
GSM1015190 ,
GSM1015191 ,
GSM1015192 ,
GSM1015193 ,
GSM1015194 ,
GSM1015195 ,
GSM1015196 ,
GSM1015197 ,
GSM1015198 ,
GSM1015199 ,
GSM1015200 ,
GSM1015201 ,
GSM1015202 ,
GSM1015203 ,
GSM1015204 ,
GSM1015205 ,
GSM1015206 ,
GSM1023100 ,
GSM1023101 ,
GSM1023102 ,
GSM1023103 ,
GSM1023104 ,
GSM1023105 ,
GSM1023106 ,
GSM1023107 ,
GSM1054012 ,
GSM1054013 ,
GSM1054014 ,
GSM1054015 ,
GSM1054016 ,
GSM1054017 ,
GSM1054018 ,
GSM1054019 ,
GSM1054020 ,
GSM1054583 ,
GSM1054584 ,
GSM1054585 ,
GSM1054586 ,
GSM1054587 ,
GSM1054588 ,
GSM1054589 ,
GSM1054590 ,
GSM1054591 ,
GSM1054592 ,
GSM1055776 ,
GSM1057800 ,
GSM1057801 ,
GSM1057802 ,
GSM1071262 ,
GSM1071263 ,
GSM1071264 ,
GSM1071265 ,
GSM1071266 ,
GSM1071267 ,
GSM1071268 ,
GSM1071269 ,
GSM1085653 ,
GSM1085654 ,
GSM1085655 ,
GSM1085656 ,
GSM1085657 ,
GSM1085658 ,
GSM1085659 ,
GSM1085660 ,
GSM1085661 ,
GSM1085662 ,
GSM1085663 ,
GSM1085664 ,
GSM1098610 ,
GSM1098611 ,
GSM1098612 ,
GSM1098613 ,
GSM1098614 ,
GSM1098615 ,
GSM1098616 ,
GSM1098617 ,
GSM1098618 ,
GSM1103441 ,
GSM1103442 ,
GSM1103443 ,
GSM1103444 ,
GSM1103445 ,
GSM1103446 ,
GSM1103447 ,
GSM1103448 ,
GSM1103449 ,
GSM1103450 ,
GSM1103451 ,
GSM1103452 ,
GSM1104066 ,
GSM1104067 ,
GSM1104068 ,
GSM1104069 ,
GSM1110815 ,
GSM1110816 ,
GSM1110817 ,
GSM1110818 ,
GSM1110819 ,
GSM1110820 ,
GSM1110821 ,
GSM1111500 ,
GSM1111501 ,
GSM1111502 ,
GSM1111503 ,
GSM1122112 ,
GSM1122113 ,
GSM1122114 ,
GSM1122115 ,
GSM1122116 ,
GSM1122117 ,
GSM1122679 ,
GSM1122680 ,
GSM1122681 ,
GSM1122682 ,
GSM1122683 ,
GSM1122684 ,
GSM1129462 ,
GSM1129463 ,
GSM1129464 ,
GSM1129465 ,
GSM1129466 ,
GSM1129467 ,
GSM1129468 ,
GSM1129469 ,
GSM1129470 ,
GSM1132965 ,
GSM1132966 ,
GSM1132967 ,
GSM1132968 ,
GSM1132969 ,
GSM1132970 ,
GSM1132971 ,
GSM1132972 ,
GSM1132973 ,
GSM1133426 ,
GSM1133427 ,
GSM1133428 ,
GSM1133429 ,
GSM1133430 ,
GSM1133431 ,
GSM1133432 ,
GSM1133433 ,
GSM1133434 ,
GSM1133435 ,
GSM1138737 ,
GSM1180581 ,
GSM1180582 ,
GSM1180583 ,
GSM1180584 ,
GSM1186193 ,
GSM1186194 ,
GSM1186195 ,
GSM1186196 ,
GSM1186197 ,
GSM1186198 ,
GSM1186199 ,
GSM1186200 ,
GSM1186201 ,
GSM1186202 ,
GSM1186203 ,
GSM1186204 ,
GSM1186205 ,
GSM1186206 ,
GSM1186207 ,
GSM1186208 ,
GSM1186209 ,
GSM1186210 ,
GSM1193008 ,
GSM1193009 ,
GSM1193010 ,
GSM1193011 ,
GSM1193012 ,
GSM1193013 ,
GSM1196223 ,
GSM1196224 ,
GSM1196225 ,
GSM1196226 ,
GSM1196227 ,
GSM1196228 ,
GSM1196229 ,
GSM1196230 ,
GSM1196231 ,
GSM1196232 ,
GSM1196233 ,
GSM1196234 ,
GSM1196235 ,
GSM1196236 ,
GSM1196237 ,
GSM1196238 ,
GSM1196239 ,
GSM1196240 ,
GSM1196241 ,
GSM1196242 ,
GSM1196243 ,
GSM1196244 ,
GSM1196245 ,
GSM1196246 ,
GSM1196247 ,
GSM1196248 ,
GSM1196249 ,
GSM1196250 ,
GSM1196251 ,
GSM1196252 ,
GSM1196253 ,
GSM1196254 ,
GSM1196255 ,
GSM1196256 ,
GSM1196257 ,
GSM1196258 ,
GSM1196259 ,
GSM1196260 ,
GSM1196261 ,
GSM1196262 ,
GSM1196263 ,
GSM1196264 ,
GSM1196265 ,
GSM1198237 ,
GSM1198238 ,
GSM1198239 ,
GSM1198240 ,
GSM1198241 ,
GSM1198242 ,
GSM1198243 ,
GSM1198244 ,
GSM1198245 ,
GSM1198246 ,
GSM1198247 ,
GSM1198248 ,
GSM1216842 ,
GSM1216843 ,
GSM1216844 ,
GSM1216845 ,
GSM1216846 ,
GSM1216847 ,
GSM1216848 ,
GSM1216849 ,
GSM1216850 ,
GSM1216851 ,
GSM1227011 ,
GSM1227012 ,
GSM1227013 ,
GSM1227014 ,
GSM1227015 ,
GSM1227016 ,
GSM1227017 ,
GSM1227018 ,
GSM1227019 ,
GSM1227020 ,
GSM1257860 ,
GSM1257861 ,
GSM1260043 ,
GSM1260044 ,
GSM1260045 ,
GSM1260046 ,
GSM1260047 ,
GSM1260048 ,
GSM1260049 ,
GSM1260050 ,
GSM1260051 ,
GSM1260052 ,
GSM1260053 ,
GSM1260054 ,
GSM1280255 ,
GSM1280256 ,
GSM1280257 ,
GSM1280258 ,
GSM1280259 ,
GSM1280260 ,
GSM1280261 ,
GSM1280262 ,
GSM1280263 ,
GSM1280264 ,
GSM1280265 ,
GSM1280266 ,
GSM1280267 ,
GSM1280268 ,
GSM1280269 ,
GSM1280270 ,
GSM1280271 ,
GSM1280272 ,
GSM1280273 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (342)
GSE25302 Synergistic Tumor Suppressor Activity of E-cadherin and p53 in a Conditional Mouse Model for Diffuse-Type Gastric Cancer
GSE31074 Essential role of gastric gland mucin in preventing gastric cancer in mice
GSE31405 Differentially expressed genes between oncogene-introduced wild-type and Atf4-/- cells
GSE32936 IGF1-receptor signalling attenuates the age-related decline of diastolic cardiac function
GSE33022 Cardiac aldosterone and corticosterone regulated genes in mice with cardiomyocytes targeted mineralocorticoid receptor overexpression (MR-Cardio mice) and their controls (Ctrl mice)
GSE33575 Hepatic gene expression profiles after long-term high-fat diet feeding in wild type and Nrf2 knock-out mice.
GSE33721 Mouse peritoneal macrophages at 3.5 or 48 hours, 0,0.5 or 5 μg/ml Leukocyte cell-derived chemotaxin 2 (LECT2),gene expression array, two independent biological replicates
GSE34049 Cardiac aldosterone regulated genes in mice with cardiomyocytes targeted mineralocorticoid receptor overexpression (MR-Cardio mice) and their controls (Ctrl mice)
GSE34760 p53 deletion induces liver carcinoma with bilineal differentiation
GSE35125 Immunomagnetic purification of mES derived neuronal precursors increases neuronal migration and differentiation in vivo
GSE35134 5/6 nephrectomy (5/6Nx) effect on the brain
GSE35135 5/6 nephrectomy (5/6Nx) effect on the liver
GSE35136 5/6 nephrectomy (5/6Nx) effect on the brain and liver
GSE35269 New protein from an unexpected ligament
GSE35559 Gene expression profile induced by Imatinib
GSE36066 Factor VII activating protease (FSAP) exerts antifibrotic effects in a mouse model of experimental liver fibrosis
GSE36604 Transcriptional profiling of cumulus cells differentiation throughout oocyte competence acquisition in the murine ovarian follicles.
GSE36617 Contribution of molecular actors from somatic origin to oocyte developmental competence acquisition, lessons from evolution
GSE36697 Effect of deletion of the selenium-binding protein 1 gene on gene expression in the ovary of C57BL/6J mouse
GSE36813 Transient telomere dysfunction induces chromosomal instability and promotes carcinogenesis in telomerase-proficient mice
GSE37576 Gene expression profile of the V/SVZ and the CP at E16
GSE37577 Gene expression profile of cerebral cortical cells after Rb family inactivation in progenitors and neurons
GSE37625 V/SVZ (ventricular/subventricular zone) tissue and CP (cortical plate) tissue at E16
GSE37762 Analysis of differential genetic expression by moderate-carbohydrate restriction diet with calorie restriction mimetic multiple phytochemicals (MCDmp) using a transgenic liver cancer model developed by a simple hydrodynamic transfection method.
GSE38095 Leptin and the Placental Response to Maternal Food Restriction during Early Pregnancy
GSE38779 Host cell subversion by Toxoplasma GRA16, an exported dense granule protein that targets the host cell nucleus and alters gene expression
GSE38782 A Toxoplasma dense granule protein, GRA24, modulates the early immune response to infection by promoting a direct and sustained host p38 MAPK activation
GSE39288 Influence of G0s2 gene knockdown on primary hepatocyte
GSE41340 Mechanistic analysis of the model obesogen Tributyltin in the 3T3-L1 cell line
GSE41718 The ShcA PTB Domain Functions as a Biological Sensor of Phospho-tyrosine Signaling During Breast Cancer Progression
GSE42959 Maternal age effect on mouse oocytes: new biological insight from proteomic analysis
GSE42991 Gene expression profiles of Tet1 knockout (T1KO), Tet2 knockout (T2KO) and Tet1/Tet2 double knockout (DKO) mouse embryonic stem cells.
GSE43064 Changes in Mouse Uterine Transcriptome in Estrus and Proestrus
GSE43169 Gene expression profiling of mature dendritic cells from mice s. c. treated with GM-CSF-gene transduced LLC cells (LLC/SeV/GM) or control cells (LLC, LLC/SeV/GFP)
GSE43783 Microarray analysis of an RXR agonist HX630 regulated gene expression in murine pituitary corticotroph tumor cells (AtT20 cell)
GSE44454 Presenilins mediate endosomal recycling via ARF6 to maintain proper lysosomal clearance
GSE45181 Max is a repressor of germ-cell-related gene expression in mouse embryonic stem cells
GSE45384 Effects of Th1- and Th17-derived factors on microglia.
GSE45424 Gene expression analysis to identify Runx1 target genes in B-cell progenitors
GSE45425 Runx1 targets in early B-cell progenitors
GSE45621 Mouse ILC2 cells from wild-type or Gfi1-KO animals
GSE45664 Six2GFPE15.5 110309
GSE45845 Sall1 co-operated with Six2 to actively maintain nephron progenitors in the embryonic kidney
GSE46034 TAp73 is a trophic factor essential for sperm cell adhesion and maturation in testis
GSE46057 Investigation of Alterations in Gene Expression in the Retina Induced by Intravitreal Injection of SH-42 and SH-80
GSE46378 Investigation of Alterations in Gene Expression in the Retina Induced by High-Affinity Peptides targeting vascular endothelial growth factor, AAP and HAN
GSE46589 Comparison of gene expression between Xist KO GS cells and wild type GS
GSE46631 Vascularised and functional human liver from an iPSC-derived organ bud transplant
GSE46813 Changes in Mouse Uterine Lumenal Epithelial Cell Transcriptome in Estrus Compared to Proestrus
GSE46814 Mouse Uterine Transcriptome in Estrus and Proestrus: whole uterine tissue and isolated lumenal epithelial cells
GSE48543 Microarray analysis of colon tissue of DSS colitis STAP-2 KO mice
GSE48872 After demyelination in the adult CNS, oligodendrocyte precursor cells revert to an immature mRNA profile and express immune cues favoring their migration
GSE49048 Investigation of Alterations in Gene Expression in the Retina Induced by Intravitreal Injection of titanium dioxide nanoparticles
GSE49266 Progression from low- to high-grade astrocytoma is characterized by transcriptomal heterogeneity and genomic number copy alterations (part 2)
GSE49269 Progression from low- to high-grade astrocytoma is characterized by transcriptomal heterogeneity and genomic number copy alterations
GSE49371 Investigation of Alterations in Gene Expression in the Retina Induced by Intravitreal Injection of gold and silicate nanoparticles
GSE50245 Dual leucine zipper kinase is required for excitotoxicity induced neuronal degeneration
GSE50709 Cardiac aldosterone regulated genes in mice
GSE52034 ZHBTc4 ES cells stably expressing EGFP vs Nr5a2-EGFP or Oct4-EGFP vs Nr5a2-EGFP
GSE52124 TAp73 is essential for germ cell adhesion and maturation in testis
GSE53004 Toxicogenomics in the 3T3-L1 cell line, a new approach for screening of obesogenic compounds
GSE53368 Copper Metabolism Domain-Containing 1 Represses Genes That Promote Inflammation and Protects Mice From Colitis and Colitis-Associated Cancer
GSE53392 Transcriptional regulation of cellular processes important in control of skeletal myogenesis by interferon-γ
GSE53787 Gene expression in cardiac macrophages
GSE54029 Distinct distributions of histone marks shape cell identities of murine hepatic progenitors and adult hepatocytes
GSE54050 Transcription repressor Bach2 is required for pulmonary surfactant homeostasis and alveolar macrophage function.
GSE54472 Induced CD103+ Dendritic Cells
GSE55444 G2/M transition for stabilizing mouse haploid ESCs: Gene Expression
GSE55446 G2/M transition for stabilizing mouse haploid ESCs
GSE55693 Prolyl-4-hydroxylase domain 3 (PHD3) is a critical terminator for cell survival of macrophages under stress conditions
GSE55919 Transcriptional analysis of live and hybridized J1 and NIH-3T3 cells
GSE56708 Change of gene expression in mouse heart after permanent occlusion of the left anterior descending artery
GSE56929 Wild type and ATG5-KO mouse dendritic cells exposed to interleukin-4 (IL4) and/or lipopolisaccharyde (LPS)
GSE57098 Transcriptome analysis of CD4+ T cells in experimental autoimmune encephalitomyelitis
GSE57525 Genome-wide analysis of High glucose-induced gene expression by Ninjurin1 siRNA
GSE57590 Phenotypic analysis of conventional knockout mice lacking a protein responsible for ossification of the posterior longitudinal ligament
GSE58152 Transcriptome of CD4+ T cell subsets
GSE58894 Effect of Gnas knockout on mouse skin
GSE59116 Core pathway mutations induce de-differentiation of murine astrocytes into glioblastoma stem cells that are sensitive to radiation but resistant to temozolomide.
GSE59603 Identifying interferon-stimulated genes enriched in multiple tissues of Irgm1-/- mice
GSE59661 LDLR-/- mice aorte: Control vs DHA
GSE60779 Med23-dependent gene expression programs in T cells
GSE60864 Microarray analysis of mouse gene expression in metronomic cyclophosphamide-treated rat glioma 9L xenografts implanted in scid mice
GSE60866 Microarray analysis of mouse gene expression in metronomic cyclophosphamide-treated human glioma U251 xenografts implanted in scid mice
GSE60913 Gene expression in metronomic cyclophosphamide-treated glioma xenografts
GSE61126 Characterization of polysome enriched mRNAs following insulin treatment
GSE61655 Pten cell autonomously regulates HSC mobilization and function via G-CSF independent mechanisms
GSE62069 Gene expression in E9.5 hearts comparing wt with Arid3b-null embryos
GSE62070 Gene expression in E9.5 heads comparing wt with Arid3b-null embryos
GSE62071 Gene expression in E9.5 trunks comparing wt with Arid3b-null embryos
GSE62072 Arid3b is required for heart development
GSE62639 Gene expression profile on wt and mdx mice treated or untreated with Tadalafil
GSE63443 Murine bone marrow derived macrophages: wildtype Vs. CDK5R1 knockout
GSE64191 Egress of mature murine regulatory T cells from the thymus requires RelA
GSE64222 Disruption of Drp1 in the liver protects mice against diet-induced obesity through induction of fibroblast growth factor 21
GSE64668 Effect of FTO (fat mass and obesity-associated) overexpression on gene expression profiling in beta cells
GSE64775 Effect of 90Sr internal emitter on gene expression in mouse blood
GSE64803 Impact of Vitamin D on murine myotubes
GSE65043 Comparative analysis of mouse CD8+ Teff cells infiltrating distinct organ targets of aGVHD by gene expression profiling
GSE65044 Characterization of resident CD8+ Trm cell populations using whole-genome biomarker analysis
GSE65045 Comparative analysis of murine CD8+ resident memory and effector T cells in various organ environments
GSE65575 Modeling Host Responses to Understand Severe Human Virus Infections
GSE65756 Glucocorticoid-regulated circadian expression genes in spinal cord of nerve-injured mice
GSE65791 Generation of PDGFRα+ Cardioblasts from Pluripotent Stem Cells
GSE66094 Gene expression analysis to characterize similarities and differences in T. canis- or T. cati-induced neurotoxocarosis
GSE66751 Transcriptional profiling of small intestinal crypts from mice treated with Notch blocking antibodies or Notch blocking antibodies in combination with an Lrp6 blocking antibody.
GSE67199 Gene expression in beta-cells in mice submitted to a high-fat diet
GSE67473 Mouse cortical neuron transcriptional response to wild-type West Nile virus (WNV-NY) and mutant virus WNV E218A [mRNA]
GSE68141 Glucagon receptor deficient liver during postnatal development
GSE68142 Anti-GCGR antibody treatment in db/db mice
GSE68145 Glucagon Couples Hepatic Amino Acid Catabolism to mTOR-dependent Regulation of α-cell Mass
GSE68380 Mouse granule cell neuron transcriptional response to wild-type West Nile virus (WNV-NY) and mutant virus WNV E218A (mRNA)
GSE68441 Muscle-specific gene expression changes in normal and high-fat diet in spinal and bulbar muscular atrophy (SBMA)
GSE68632 Gene expression Tet-mev-1 mouse fed either normal diet or high fat high sucrose diet compared with wild type mouse
GSE68903 Development of gene sets after deleting Rb in p53 null background primary prostate cells [Rb only]
GSE68905 Development of gene sets after deleting Rb or Rb and Pten in p53 null background primary prostate cells
GSE68945 Mouse lung tissue transcriptome response to a wild type infectious clone of H7N9 Influenza virus and mutant H7N9 viruses [mRNA]
GSE69741 Expression data of Met-low and Met-high B16-F10 malignant melanoma cells
GSE69897 Gene expression profile of mouse embryonic stem cells derived cardiomyocytes following the knockdown of ErbB4
GSE69908 Gene Expression Profiling of Murine Melanomas Exhibiting Differential Tumorigenicities
GSE69941 Placental changes caused by food restriction during early pregnancy in mice are reversible
GSE69945 Mouse lung tissue transcriptome response to H1N1, H5N1, and mutants [mRNA]
GSE70134 Wnt/b-catenin signaling regulates sequential fate decisions of murine cortical precursor cells
GSE70296 Effect of GW4064 on primary cultured mouse kidney proximal tubule cells
GSE70306 Comparison of mRNA expression pattern between wild-type regulatory T (Treg) cells and Nr4a-deficient Treg cells
GSE71282 Comparative gene profiling study: Pak1 deficient mouse breast cancer cells vs Pak1 wt breast cancer cells
GSE71426 MHC Class I antibody induced gene expression in mouse obliterative airway disease
GSE71685 Transcriptional response induced by enteropathogenic Escherichia coli (EPEC) in mouse intestinal epithelial cells in vivo
GSE71759 Mouse lung tissue transcriptome response to influenza H5N1 and mutants [mRNA](Agilent-026655)
GSE71814 The effect of whole-glucan particles on the gene expression of polarized M2 bone-derived macrophages
GSE71980 Foxp3 is a key downstream regulator of p53-mediated cellular senescence
GSE72102 CnAb1 knock down in R1 mESCs differentiated to mesoderm in Ebs
GSE72103 CnAb1
GSE72122 Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival
GSE72206 Comparative Gene Profiling Study Between Pak1 Deficient Mouse and Human Breast Cancer Cells
GSE72992 Regeneration in the pituitary after cell-ablation injury: time-related aspects and molecular analysis
GSE73290 Hepatic transcriptome of mice fed high fat diets containing palm or linseed oil
GSE73524 overexpression/knockdown MEG3 in C2C12 cell lines
GSE73760 Gene expression profile of spleen B cells from Dock10 knockout mice and its regulation by IL-4
GSE73983 Puberty-specific promotion of mammary tumorigenesis by a high animal fat diet
GSE74073 Influenza H3N2 infection of the Collaborative Cross founder strains reveals highly divergent host responses and identifies a unique phenotype in CAST/EiJ mice (blood)
GSE74074 Influenza H3N2 infection of the Collaborative Cross founder strains reveals highly divergent host responses and identifies a unique phenotype in CAST/EiJ mice (lung)
GSE74077 Influenza H3N2 infection of the Collaborative Cross founder strains reveals highly divergent host responses and identifies a unique phenotype in CAST/EiJ mice
GSE74294 Puberty-specific promotion of mammary tumorigenesis by a high animal fat diet in P53 -/- mice
GSE74628 Mouse primary myeloid dendritic cell transcriptome response to a wild type infectious clone of West Nile virus (WNVMT) and mutant virus (WNVE218A).
GSE74695 The alarmin IL-33 amplifies an immune response in the degenerating retina
GSE74995 Cortex PS2 APP transgenic mice
GSE75222 Primary mouse myeloid dendritic cell transcriptome response to a wild type infectious clone of West Nile virus (WNVMT) and mutant virus (WNVE218A).
GSE75378 The effect of palmitate on gene expression profile in proliferating myoblasts
GSE75660 Gene expression profile of Epiblast stem cells
GSE75686 Comparison of gene expression profiles between wild-type and Dock8-deficient CD4+ T cells
GSE76805 Activity-induced Nr4a1 regulates spine density and distribution pattern of excitatory synapses in pyramidal neurons
GSE76843 Direct reprogramming of hepatic myofibroblasts into hepatocytes in vivo attenuates liver fibrosis
GSE77192 Mouse cerebellum transcriptome response to a wild type West Nile virus (WNV), New York 99 Strain, and mutant WNV-E218A viruses [WCB001_mRNA]
GSE77193 Mouse cortex transcriptome response to a wild type West Nile virus (WNV), New York 99 Strain, and mutant WNV-E218A viruses [WCT001_mRNA]
GSE77306 Gene expression profiles of B cells under various conditions
GSE77506 Gene expression analysis in mouse podocytes expressing shRNA directed against the long noncoding RNA Tug1
GSE77600 Irf3 phenotyping
GSE78191 Transcript profiling in splenic red pulp macrophages from SIRPa-KO mice and WT mice
GSE78841 Time course of gene expression signatures for Tet3 induced neurons
GSE78888 Mouse popliteal lymph node transcriptome response to a wild type West Nile virus (WNV), New York 99 Strain, and mutant WNV-E218A viruses [mRNA]
GSE79083 CD8+ T cell response in the Act-mOVA/OT-I model of acute graft versus host disease
GSE79109 The gene expression pattern of mice fed the resveratrol-enriched rice DJ526 was very different from mice fed either resveratrol or Dongjin rice alone
GSE79248 Type-I interferon inducible genes 26 weeks after mCMV infection in Siglec-H wt and Siglec-H ko mice and their non infected controls
GSE79536 The calcineurin splicing variant CnAb1 reduces pressure overload-induced cardiac hypertrophy by promoting mitohormesis
GSE79607 SIRT1 negatively regulates the differentiation of IL-9-producing CD4+T cells
GSE79643 Development of gene expression signatures for CXXC5 in pDCs
GSE79713 Gene transcription profiles of spleen dentritic cells in mice infected with Schistosoma japonicum in N day, 28 day, 63 day
GSE79747 Development of gene expression signatures for identifying novel factors that can overcome age-associated reprogramming barriers
GSE79847 Hyponutrition during pregnancy after insemination alters the progenies’ behavior and DNA methylation of their brain
GSE80692 Circadian gene expression profile of pancreatic islets from C57BL6 mice fed on rodent chow diet collected at 4hr intervals around the clock
GSE80740 Investigation of ripk3-dependent IAV-induced genes
GSE81177 Gene expression analysis to identify Runx1 target genes in GMP
GSE81182 Runx1 downregulates stem cell and megakaryocytic transcription programs that support niche interactions
GSE81389 Immunomodulatory mechanism of Cordyceps militaris polypeptide through regulating gene in mice
GSE81658 Mouse Primary Cultured Hepatocytes: Control vs SQ1 or Pravastatin treatment.
GSE81659 Expression data from squalestatin 1- or pravastatin-treated primary cultured mouse and rat hepatocytes.
GSE82771 Screening for Protective Effect Target of Deproteinized Extract of Calf Blood and Its Mechanisms in Mice with CCl4-Induced Acute Liver Injury
GSE83639 Gene expression affected by loss-of- or gain-of-function of Dmrt3/Dmrta2 in the dorsomedial telencephalon
GSE83700 Effect of High-Fat Diet on Mouse Liver Gene Expression
GSE83915 Comparison of gene expression changes in TSA tumors following different radiation regimens.
GSE84509 Gene expression profiling in murine granulocyte-monocyte progenitors (GMP), common dendritic cell progenitors (CDP), committed precursors of classical dendritic cells (pre-cDC), Ly6C+ monocytes (Mo), CD4+ cDC, CD8+ cDC, and neutrophils (Neu)
GSE85411 Gene expression in alveolar macrophages between bleomycin–treated wild-type and S1pr2-/- mice.
GSE85729 Increased tumourigenesis in ApcMin/+ mice fed with a Western-type diet associates with changes in PDK4, Erk/Akt and mTor pathways, intestinal immunity and the expression of energy metabolism-related genes
GSE86005 Selective de-repression of germ cell-specific genes in mouse embryonic fibroblasts in a permissive epigenetic environment
GSE86343 A member of the mycobiota modulates purine metabolism to increase intestinal permeability and colitis
GSE86582 Exposure to a low-dose pollutant mixture does not trigger obesity in female mice but results in metabolic disturbances showing both common and specific features as compared to a high-fat diet challenge
GSE88921 Microarray analysis of gene expression patterns in wildtype and LIFR knockout and gp130 knockout ESCs
GSE89077 DNA microarray analysis of colorectal tissue from Apc mutant mice
GSE89543 Overexpression of MXRA7 in murine prostate cancer cell line RM1
GSE89738 Characteristic energy metabolism in mouse primordial germ cells
GSE89907 mRNA expression profiling in myocardial tissue by caloric restriction initiated in different aged mice
GSE89909 mRNA and miRNA expression profiling in myocardial tissue by caloric restriction initiated in different aged mice
GSE89986 Gene expression profiling in mouse spleen
GSE90127 Gene array analysis of primary mouse calvaria osteoblasts without differentiation, with differentiation, or with differentiation plus cabozantinib (XL184)
GSE90158 A paternal methyl donor-rich diet altered cognitive and neural functions in offspring mice [expression profiling]
GSE90504 A paternal methyl donor-rich diet altered cognitive and neural functions in offspring mice
GSE91382 Differential response of polarized gut epithelial cells to type I and III interferon
GSE92234 Hypothalamic oxidative stress provokes leptin and insulin resistance [Islets]
GSE92235 Hypothalamic oxidative stress provokes leptin and insulin resistance [hypothlamus]
GSE92236 Hypothalamic oxidative stress provokes leptin and insulin resistance
GSE92439 Effects of exosomes from T lymphocytes of NOD mice on pancreatic islet-cell gene expression
GSE95178 Genome-wide analysis of High glucose-induced gene expression by DKK2 protein
GSE96053 Dlk response to optic nerve injury
GSE97316 Study on the mechanism of Shcisandrol A in immune function modulation in mice based on the mRNA expression profile chip
GSE97555 Mouse lung tissue transcriptome response to H1N1 and mutants
GSE99176 Global gene expression in response to X rays in mouse models of DNA repair deficiency
GSE99467 Gene Expression Changes in MDP and CDP from PyMT B6 Tumor Bearing Mice
GSE99625 Host-directed adjunctive therapy with pravastatin against chronic TB in mice
GSE100593 Gene expressions of BMDC with or without Rbpj
GSE101402 Global gene expression in response to X rays in mice deficient in Parp1
GSE101469 Development of gene expression signatures for experimental lingual carcinogenesis
GSE102087 lncRNA SYISL contributes to the genome-wide expression during myogenic differentiation
GSE102150 Integrative analysis of hepatic microRNA and mRNA to identify potential biological pathways associated with monocrotaline-induced liver injury in mice
GSE102610 DNMTs and SETDB1 function as co-repressors in MAX-mediated repression of germ cell-related genes in mouse embryonic stem cells
GSE102832 Expression profiling macrophage subsets [P1301]
GSE102834 Expression profiling macrophage subsets [P1991]
GSE102835 Expression profiling macrophage subsets [P2538]
GSE102836 Expression profiling macrophage subsets
GSE102977 C57BL/6J WT mice liver and adipose: normal diet (ND) vs. high-fat diet (HFD)
GSE103533 Effect of Cyp3a-cluster knockout on liver
GSE103534 Effect of Cyp3a-cluster knockout on small intestine
GSE103694 Baf53a is involved in survival of mouse ES cells, which can be compensated by Baf53b.
GSE103696 Endogenous gene expression profiling of Cyp3a-cluster knockout mice
GSE104031 Evaluation of animal models of AD
GSE104244 Bone Marrow Derived Macrophages, NSCLC cell lines, and Kras G12D Lung Tumors Treated with Epigenetic Agents
GSE105097 Effects of circHIPK3 silencing on mRNA expression
GSE106400 Gene expression profile of Ba/F3 variant (#BEB1) cells that have binding ability to Ecrg4
GSE106424 Ezh2 is essential for activation-induced CD8+ T cell cycle progression via repressing Cdkn1a and Cdkn2c expression (Part I)
GSE106426 Ezh2 is essential for activation-induced CD8+ T cell cycle progression via repressing Cdkn1a and Cdkn2c expression
GSE106620 Long-term neuroinflammation induced by influenza A virus infection and the impact on hippocampal neuron morphology and function
GSE107567 Load-Dependent Changes in Left Ventricular Gene Expression in a Pathophysiologically Relevant Murine Model of Reversible Heart Failure (2 weeks heart failure, 2 weeks reversal)
GSE107569 Load-Dependent Changes in Left Ventricular Gene Expression in a Pathophysiologically Relevant Murine Model of Reversible Heart Failure
GSE108169 Liver gene expression profiles of catalase knockout mice fed normal and high fat diet
GSE108594 Lung cell transcriptome response to a wild type Mers-CoV
GSE110065 Comparison of primary vs immortalized murine hepatocytes
GSE110109 Gene expression profile of SoNar-high and SoNar-low fetal liver blood cells
GSE110111 Gene expression profile of SoNar-high and SoNar-low B-cell acute lymphoblastic leukemia (B-ALL) cells
GSE110112 Gene expression profile of SoNar-high and SoNar-low fetal liver blood cells and B-cell acute lymphoblastic leukemia (B-ALL) cells
GSE110384 The host response to influenza virus infection
GSE110771 IL-4 effect on mouse bone marrow-derived macrophages
GSE111399 Characteristics of differentiated newly identified adipose precursor cells
GSE111679 Gene expression in CD163-deficient resident macrophages
GSE112121 Spatiotemporal transcriptome of the mouse dentate gyrus
GSE112390 Identification of age-related changes in gene expression and chromatin accessibility in T cells from thymus to periphery (44K)
GSE112392 Identification of age-related changes in gene expression and chromatin accessibility in T cells from thymus to periphery
GSE113509 Identification of differentially expressed genes and pathways in mice exposed to mixed field neutron/x-ray radiation
GSE113626 The Toxoplasma effector TEEGR promotes parasite persistence by modulating NF-κB signalling via EZH2
GSE113658 The Toxoplasma effector TEEGR promotes parasite persistence by modulating NF-κB signalling via EZH2
GSE114142 Gene expression response in mouse model of inflammatory bowel disease to ionizing radiation
GSE114243 The role of DOCK10 in the regulation of the transcriptome and aging
GSE114719 Differential expressed genes in respone to diesel exhaust particle (DEP) on mouse nasal cavity
GSE115107 Transforming the Spleen into a Functioning Liver In Vivo
GSE115152 Role of Selenium Intake for Risk and Development of Graves’ Disease
GSE115333 Jun O-GlcNAcylatSchwann cell O-GlcNAcylation promotes peripheral nerve remyelination via attenuation of the AP-1 transcription factor JUNion promotes peripheral nerve remyelination after nerve injury
GSE117571 Foxc1 and Foxc2 are necessary to maintain glomerular podocytes
GSE118616 Mouse blood gene expression after administration of 137 Cesium
GSE119415 Evaluation of gene expression changes in wild type (C57BL/6) vs Angelman syndrome (AS) model mice
GSE122054 Expression data from mouse preadipocyte 3T3-L1 and slincRAD-shRNA-8 cells
GSE122558 Transcripts identified by microarray analysis that were deregulated in E13.5 Tbx18cre/+;HprtTbx2/Y (Tbx2-GOF) ureters
GSE122561 TBX2 and TBX3 act downstream of canonical WNT signaling in patterning and differentiation of the ureteric mesenchyme
GSE123332 Follicular helper T cells enhance autoimmunity through Ascl-2 in a murine model for Sjögren’s syndrome
GSE123505 Gene expression profiling of mobilized vs. Bone marrow (BM) resident hematopoietic stem and progenitor cells (LSK)
GSE124078 STAT4 activation by leukemia inhibitory factor confers a therapeutic effect on intestinal inflammation [array]
GSE124079 STAT4 activation by leukemia inhibitory factor confers a therapeutic effect on intestinal inflammation
GSE124348 STAT3 secretion defect results in development abnormally
GSE124354 Mouse ES Cells: Wild type vs. Zscan5b knockout
GSE124360 RAW246.1 cells activation by internalized synthetic miR-122
GSE124612 Transcriptomic responses in mouse blood during the first week after in vivo gamma irradiation
GSE125430 High-salt diet inhibits tumour growth in mice via regulating myeloid-derived suppressor cells differentiation
GSE126343 The role of mirna-146b-tbc1d14 in the autophagy of RAW264.7 cells mediated by B. melitensis m5-90 [mRNA]
GSE126499 The role of mirna-146b-tbc1d14 in the autophagy of RAW264.7 cells mediated by B. melitensis m5-90
GSE127702 Transcripts identified by microarray analysis that were deregulated in E14.5 Tbx18cre/+;Gata2fl/fl (Gata2cKO) ureters
GSE128895 A novel deactivation factor of fibrogenic hepatic stellate cells induces regression of liver fibrosis in mice
GSE130718 Determinaton the effect of IR-61 on macrophage gene expression
GSE132559 Impact of aging on gene expression response to x-ray irradiation using mouse blood
GSE133359 Gene expression profile in hearts of WT and endothelial S1pr1 knock-out mice 5 days after myocardial infarction
GSE133451 The effect of aging on the transcriptional profile of female mice exposed to x-ray radiation
GSE133577 Effects of entero-gastro-anastomosis (EGA) surgery in ob/ob mice on pancreatic islet gene expression
GSE133852 ob/ob mice on pancreatic islet
GSE136922 Development of gene expression signatures using herbal drug ninjin'yoeito (NYT)
GSE139297 Murine Th2, Th9, and iTreg transcriptome
GSE139890 Zinc effect on mice
GSE139967 Transcriptome profiling of liver derived from calcium channel ITPR2 KO mice
GSE139982 Transcriptome profiling of early or late passage MEFs derived from calcium channel ITPR2 KO mice
GSE141110 Induction of steatohepatitis and liver tumorigenesis by enforced Snail expression in hepatocytes
GSE142545 Effects of deproteinized extract of calf blood on the energy metabolism of acute hypoxia model mice and its targets
GSE144328 Peri-pubertal High-Fat Diet Promotes c-Myc Stabilization in Mammary Gland Epithelium
GSE147857 Gene expression signatures in IRF7 overexpressed 3T3-L1 adipocytes
GSE147858 Gene expression signatures in 3T3-L1 adipocytes 2, 8 and 20 days after the induction of adipocyte differentiation
GSE151106 Gene expression profile of SoNar-high and SoNar-low B-cell acute lymphoblastic leukemia (B-ALL) cells
GSE153236 Brd/BET Proteins Influence the Genome-Wide Localization of the Kaposi’s Sarcoma-associated Herpesvirus and Murine Gammaherpesvirus Major Latency Proteins [mouse array]
GSE153244 Brd/BET Proteins Influence the Genome-Wide Localization of the Kaposi’s Sarcoma-associated Herpesvirus and Murine Gammaherpesvirus Major Latency Proteins
GSE154305 Transcripts identified by microarray analysis that were deregulated in E10.5 Pax2-cre;Tbx2(fl/fl);Tbx3(fl/fl) (Tbx2/3cDKO) otocysts.
GSE154733 Gene expression signatures of CD11b+ cells in mice after myocardial infarction
GSE155070 Expression data from C2C12 cells after knocking-down lncRNA-MEG3
GSE156181 Receptor Notch-3 - role in kidney fibrosis using an UUO model
GSE156888 Comparative genomic analysis focused on early and intermediate phases of cellular reprogramming
GSE160039 Impact of Wnt6 knockout in Mtb infected murine BMDM
GSE162549 Difference in gene expression signatures of Ebf1-deficient pro-B cell lines with and without the ability to differentiate into T cell lineage
GSE163261 Comprehensive Dissection of CircRNA-Associated-ceRNA Networks in Cardiac Transplant Rejection Immunity
GSE163488 Transgenic mice overexpressing the LH receptor in the female reproductive system spontaneously develop endometrial tumour masses
GSE169662 Transcripts identified by microarray analysis that were deregulated in E18.5 Tbx18(cre/+);Rbpj(fl/fl) (Rbpj-cKO) ureters
GSE172242 Reprogramming the spleen into a functioning “liver” in vivo I
GSE172243 Reprogramming the spleen into a functioning “liver” in vivo II
GSE172244 Reprogramming the spleen into a functioning “liver” in vivo III
GSE172245 Reprogramming the spleen into a functioning “liver” in vivo
GSE179912 Gene expression data of the liver in hepatocyte-specific Phgdh knockout mice
GSE181128 The differencial expression of cardiac-specific NPRA-deficient mice compares to wild type.
GSE182906 Topical estrogen application promotes cutaneous wound healing in db/db female mice with type 2 diabetes
GSE184361 Effect of the p38 mitogen-activated protein kinase signaling cascade on radiation biodosimetry
GSE189239 Effect of IP6K2-deletion on mRNA expression in mouse spinal cord and duodenum
GSE189308 addition of proteasome inhibitor to J774 cells
GSE190123 Toxocara canis- and Toxocara cati-induced neurotoxocarosis is associated with comprehensive brain transcriptomic alterations
GSE191009 Brown adipose TRX2 deficiency activates mtDNA-NLRP3 to impair thermogenesis and protect against diet-induced insulin resistance
GSE193735 Effects on gene expression by Aff3-deficiency
GSE196400 Effect of the autoimmune suppressor Gadd45a on radiation biodosimetry
GSE198376 Transcriptome analysis of myeloid cells after acute myocardial infarction (AMI) in C57BL/6N wild-type mice.
GSE198574 Development of gene expression signatures for neonatal tissues of mice with Usp10 gene knockout
GSE198771 Analysis of resident peritoneal macrophage's transcriptome in WT and CGD mice
GSE198778 The leukocyte NADPH oxidase 2 (NOX2) plays a key role in pathogen killing and immunoregulation
GSE199399 Identification of circular RNAs and mRNAs expression profiles in microglia M2 polarization [mRNA]
GSE199400 Identification of circular RNAs and mRNAs expression profiles in microglia M2 polarization
GSE208013 Ameliorative effect of the oil components derived from sweet potato shochu on impaired short-term memory in mice after amyloid ß25-35 injection
GSE210060 Transformed cells after senescence give rise to more severe tumor phenotypes than transformed non-senescent cells
GSE213868 Loss of LOXL2 promotes uterine hypertrophy and tumor progression
GSE216995 Gene expression in BMDM treated with GW4064
GSE220080 Muscle-specific gene expression changes in spinal and bulbar muscular atrophy (SBMA) at presymptomatic timepoint
GSE225548 Murine lenses:βB2-crystallin W151C knock-in mice vs.wild type control mice
GSE232188 Irisin regulated genes in mouse liver derived AML12 cells
GSE233364 Analysis of Gene Expression Profile Alterations During NBXH Treatment for Tuberculosis
GSE233735 HSP27 (Heat Shock Protein 27, HSPB1) overexpression effect on bleomycin-induced PF (Pulmonary fibrosis) mice model
GSE235166 Assessment of the molecular mechanism associated with osteogenic and angiogenic differentiation induced by FeMnSi scaffold
GSE236358 Chronic sleep fragmentation reduces left ventricular contractile function and alters gene expression related to innate immune response and circadian rhythm in the mouse heart
GSE240916 Loss of SIRPα promotes podocytes presenting antigen to activate specific T cell immune responses in lupus nephritis via activating spleen tyrosine kinase
GSE241722 Cardiomyocyte S1pr1 regulates cardiac regeneration via AKT/mTOR signaling pathway
GSE241836 Analysis of the effect of prenatal alcohol exposure on the Placenta—Cortex transcriptomic signature
GSE246669 Analysis of expression profiles in miR-195 transduced Ebf1–/– Lin– cells
GSE266384 A comprehensive gene expression analysis to identify the key regulator suppressing the IFN-γ-inducible factors in tumor cells
GSE271656 Transcriptome analysis of embryos of STAT3-K177R/K180R mutant mice
GSE276937 Transcriptomics-based anti-tuberculous mechanism of traditional Chinese polyherbal preparation NiuBeiXiaoHe intermediates
GSE281520 Sec15 Controls STAT3 Traffic Direction to Modulate Hematopoietic Stem Cell Fate
Relations Alternative to
GPL10333
Data table header descriptions ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence
Data table ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE (+)E1A_r60_1
(+)E1A_r60_1
pos
(+)E1A_r60_3
(+)E1A_r60_3
pos
(+)E1A_r60_a104
(+)E1A_r60_a104
pos
(+)E1A_r60_a107
(+)E1A_r60_a107
pos
(+)E1A_r60_a135
(+)E1A_r60_a135
pos
(+)E1A_r60_a20
(+)E1A_r60_a20
pos
(+)E1A_r60_a22
(+)E1A_r60_a22
pos
(+)E1A_r60_a97
(+)E1A_r60_a97
pos
(+)E1A_r60_n11
(+)E1A_r60_n11
pos
(+)E1A_r60_n9
(+)E1A_r60_n9
pos
(-)3xSLv1
(-)3xSLv1
neg
A_51_P100034
A_51_P100034
FALSE
NM_027162 NM_027162 69674 Mif4gd
MIF4G domain containing
Mm.390387
ref|NM_027162|ref|NM_001243586|ref|NM_001243587|ref|NM_001243584
chr11:115469328-115469269
mm|11qE2
Mus musculus MIF4G domain containing (Mif4gd), transcript variant 1, mRNA [NM_027162]
GO:0005488(binding)|GO:0005575(cellular_component)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006417(regulation of translation)|GO:0008022(protein C-terminus binding)|GO:0016070(RNA metabolic process)
GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG
A_51_P100174
A_51_P100174
FALSE
NM_008613 NM_008613 17427 Mns1
meiosis-specific nuclear structural protein 1
Mm.387671
ENSMUST00000034746
ref|NM_008613|ens|ENSMUST00000034746|gb|D14849|gb|AK132772
chr9:72306274-72306333
mm|9qD
Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA [NM_008613]
GO:0003674(molecular_function)|GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005882(intermediate filament)|GO:0007126(meiosis)|GO:0008150(biological_process)
CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT
A_51_P100208
A_51_P100208
FALSE
NM_177906 NM_177906 330908 Opcml
opioid binding protein/cell adhesion molecule-like
Mm.379474
ENSMUST00000115243
ref|NM_177906|ens|ENSMUST00000115243|gb|AK048730|gb|BC076581
chr9:28731887-28731946
mm|9qA4
Mus musculus opioid binding protein/cell adhesion molecule-like (Opcml), mRNA [NM_177906]
TTTGGGTTTTCTTTGGCATAAACCTTATTTCTAGAAATCCTCATGTCCAATTGCTTTCCC
A_51_P100289
A_51_P100289
FALSE
NM_020493 NM_020493 20807 Srf
serum response factor
Mm.45044
ENSMUST00000015749
ref|NM_020493|ens|ENSMUST00000015749|tc|TC1577357|tc|TC1718111
chr17:46683795-46683788
mm|17qC
Mus musculus serum response factor (Srf), mRNA [NM_020493]
GO:0000790(nuclear chromatin)|GO:0001076(RNA polymerase II transcription factor binding transcription factor activity)|GO:0001077(RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001569(patterning of blood vessels)|GO:0001701(in utero embryonic development)|GO:0001707(mesoderm formation)|GO:0001764(neuron migration)|GO:0001829(trophectodermal cell differentiation)|GO:0001947(heart looping)|GO:0002011(morphogenesis of an epithelial sheet)|GO:0002042(cell migration involved in sprouting angiogenesis)|GO:0002521(leukocyte differentiation)|GO:0003677(DNA binding)|GO:0003682(chromatin binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0003705(sequence-specific distal enhancer binding RNA polymerase II transcription factor activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005783(endoplasmic reticulum)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006366(transcription from RNA polymerase II promoter)|GO:0007015(actin filament organization)|GO:0007160(cell-matrix adhesion)|GO:0007275(multicellular organismal development)|GO:0007369(gastrulation)|GO:0007507(heart development)|GO:0007616(long-term memory)|GO:0008134(transcription factor binding)|GO:0008285(negative regulation of cell proliferation)|GO:0008306(associative learning)|GO:0009725(response to hormone stimulus)|GO:0010669(epithelial structure maintenance)|GO:0010735(positive regulation of transcription via serum response element binding)|GO:0010736(serum response element binding)|GO:0016337(cell-cell adhesion)|GO:0021766(hippocampus development)|GO:0022028(tangential migration from the subventricular zone to the olfactory bulb)|GO:0030036(actin cytoskeleton organization)|GO:0030038(contractile actin filament bundle assembly)|GO:0030155(regulation of cell adhesion)|GO:0030168(platelet activation)|GO:0030220(platelet formation)|GO:0030336(negative regulation of cell migration)|GO:0031175(neuron projection development)|GO:0031490(chromatin DNA binding)|GO:0033561(regulation of water loss via skin)|GO:0034097(response to cytokine stimulus)|GO:0035855(megakaryocyte development)|GO:0035912(dorsal aorta morphogenesis)|GO:0042803(protein homodimerization activity)|GO:0043149(stress fiber assembly)|GO:0043565(sequence-specific DNA binding)|GO:0043589(skin morphogenesis)|GO:0045059(positive thymic T cell selection)|GO:0045214(sarcomere organization)|GO:0045597(positive regulation of cell differentiation)|GO:0045893(positive regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0045987(positive regulation of smooth muscle contraction)|GO:0046016(positive regulation of transcription by glucose)|GO:0046716(muscle cell homeostasis)|GO:0046983(protein dimerization activity)|GO:0048589(developmental growth)|GO:0048821(erythrocyte development)|GO:0051491(positive regulation of filopodium assembly)|GO:0055003(cardiac myofibril assembly)|GO:0060218(hemopoietic stem cell differentiation)
GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT
A_51_P100298
A_51_P100298
FALSE
NM_152220 NM_152220 20908 Stx3
syntaxin 3
Mm.272264
ENSMUST00000112965
ref|NM_152220|ens|ENSMUST00000112965|ens|ENSMUST00000069285|gb|AK170105
chr19:11859903-11857591
mm|19qA
Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA [NM_152220]
GO:0001950(plasma membrane enriched fraction)|GO:0005484(SNAP receptor activity)|GO:0005515(protein binding)|GO:0005886(plasma membrane)|GO:0005911(cell-cell junction)|GO:0006810(transport)|GO:0006836(neurotransmitter transport)|GO:0006886(intracellular protein transport)|GO:0006887(exocytosis)|GO:0006944(cellular membrane fusion)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016192(vesicle-mediated transport)|GO:0016324(apical plasma membrane)|GO:0030426(growth cone)|GO:0031175(neuron projection development)|GO:0031201(SNARE complex)|GO:0034599(cellular response to oxidative stress)|GO:0042581(specific granule)|GO:0042582(azurophil granule)|GO:0043005(neuron projection)|GO:0050544(arachidonic acid binding)
ATCGCCATGCTGGTGGAAAATCAGGGGGAGATGTTAGATAACATAGAGTTGAATGTCATG
A_51_P100309
A_51_P100309
FALSE
NM_001039652 NM_001039652 18390 Oprm1
opioid receptor, mu 1
Mm.457998
ENSMUST00000092734
ref|NM_001039652|ens|ENSMUST00000092734|ens|ENSMUST00000056385|ens|ENSMUST00000150374
chr10:3516213-3516154
mm|10qA1
Mus musculus opioid receptor, mu 1 (Oprm1), mRNA [NM_001039652]
GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004979(beta-endorphin receptor activity)|GO:0004985(opioid receptor activity)|GO:0005624(membrane fraction)|GO:0005886(plasma membrane)|GO:0005925(focal adhesion)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007191(activation of adenylate cyclase activity by dopamine receptor signaling pathway)|GO:0007193(inhibition of adenylate cyclase activity by G-protein signaling pathway)|GO:0007218(neuropeptide signaling pathway)|GO:0007268(synaptic transmission)|GO:0007610(behavior)|GO:0007626(locomotory behavior)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0030425(dendrite)|GO:0031635(inhibition of adenylate cyclase activity by opioid receptor signaling pathway)|GO:0031681(G-protein beta-subunit binding)|GO:0032100(positive regulation of appetite)|GO:0032590(dendrite membrane)|GO:0032839(dendrite cytoplasm)|GO:0038003(opioid receptor signaling pathway)|GO:0038047(morphine receptor activity)|GO:0042383(sarcolemma)|GO:0043204(perikaryon)|GO:0044424(intracellular part)|GO:0045121(membrane raft)|GO:0051930(regulation of sensory perception of pain)|GO:0060079(regulation of excitatory postsynaptic membrane potential)
GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT
A_51_P100327
A_51_P100327
FALSE
NM_013683 NM_013683 21354 Tap1
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Mm.482076
ENSMUST00000166582
ref|NM_013683|ref|NM_001161730|ens|ENSMUST00000166582|ens|ENSMUST00000041633
chr17:34330854-34330913
mm|17qB1
Mus musculus transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (Tap1), transcript variant 1, mRNA [NM_013683]
GO:0000166(nucleotide binding)|GO:0001916(positive regulation of T cell mediated cytotoxicity)|GO:0005215(transporter activity)|GO:0005524(ATP binding)|GO:0005739(mitochondrion)|GO:0005783(endoplasmic reticulum)|GO:0005792(microsome)|GO:0005886(plasma membrane)|GO:0006200(ATP catabolic process)|GO:0006810(transport)|GO:0006952(defense response)|GO:0008152(metabolic process)|GO:0015031(protein transport)|GO:0015197(peptide transporter activity)|GO:0015421(oligopeptide-transporting ATPase activity)|GO:0015833(peptide transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0017111(nucleoside-triphosphatase activity)|GO:0019060(intracellular transport of viral proteins in host cell)|GO:0019885(antigen processing and presentation of endogenous peptide antigen via MHC class I)|GO:0030176(integral to endoplasmic reticulum membrane)|GO:0042270(protection from natural killer cell mediated cytotoxicity)|GO:0042288(MHC class I protein binding)|GO:0042605(peptide antigen binding)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)|GO:0042803(protein homodimerization activity)|GO:0042825(TAP complex)|GO:0043531(ADP binding)|GO:0046967(cytosol to ER transport)|GO:0046978(TAP1 binding)|GO:0046979(TAP2 binding)|GO:0046980(tapasin binding)|GO:0046982(protein heterodimerization activity)|GO:0055085(transmembrane transport)
TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG
A_51_P100347
A_51_P100347
FALSE
NM_001033341 NM_001033341 240476 Zfp407
zinc finger protein 407
Mm.329575
ENSMUST00000125763
ref|NM_001033341|gb|AK032536|ens|ENSMUST00000125763|tc|TC1605152
chr18:84731042-84730983
mm|18qE4
Mus musculus zinc finger protein 407 (Zfp407), mRNA [NM_001033341]
GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)
CAAATGAAACTCAGAGGATGTATATGAAACACTTTAGAACACAGATGAAAACAAACGCAC
A_51_P100519
A_51_P100519
FALSE
XM_003085003 XM_003085003 Mm.396159
ENSMUST00000062438
ens|ENSMUST00000062438|ref|XM_003085003|ref|XM_003085900|gb|AK016018
chr14:25435102-25435043
mm|14qA3
RIKEN cDNA 4930542C16 gene [Source:MGI Symbol;Acc:MGI:1922413] [ENSMUST00000062438]
GCTATCTGTTTTTTCAAACATAGATGTGGAATTAGGAAGTGAGAAAGAAATGGAATCTGG
39486 24780 Kbytes .Supplementary data files not provided
Less...
More...