GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Platform GPL7202

Query DataSets for GPL7202

Status

Public on Aug 22, 2008

Title

Agilent-014868 Whole Mouse Genome Microarray 4x44K G4122F (Probe Name version)

Technology type

in situ oligonucleotide

Distribution

commercial

Organism

Mus musculus

Manufacturer

Agilent Technologies

Manufacture protocol

see manufacturer's web site at http://www.agilent.com/

Catalog number

G4122F

Description

Designed to truly represent all known genes in the mouse genome and their resulting transcripts, Agilent's Whole Mouse Genome Oligo – 4X44K microarray is comprised of 41,534 60-mer oligonucleotide probes representing over 41,000 mouse genes and transcripts. Content for this microarray was generated from leading public databases, including RefSeq, RIKEN, NIA, Ensembl, RIKEN, UCSC Goldenpath, and Unigene.

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL4134.

Submission date

Aug 22, 2008

Last update date

Jan 12, 2017

Organization

Agilent Technologies

E-mail(s)

[email protected]

Phone

877-424-4536

URL

http://www.agilent.com

Department

Street address

City

Palo Alto

State/province

ZIP/Postal code

94304

Country

USA

Samples (10680)

More...

GSM315377, GSM315378, GSM315379, GSM315380, GSM330311, GSM330312

Series (654)

More...

GSE12541	Aldehyde oxidase homologue 2 (Aoh2) knockout mouse and retinoic acid synthesis
GSE13163	Gene expression in the pancreatic lymph node of Deaf1 knock out mice vs. BALB/c controls
GSE13358	Mouse ES cells' gene expression difference compared with that of the MEF cells

GSE13382	Distinct roles of FOXA2 and FOXA3 in allergic airway disease
GSE13462	Comparison of human ES cells, mouse ES cells, rat iPS cells and their somatic cells.
GSE13502	Gene expression analysis of Ox40-cre/ROSA-YFP CD4+ T cell subsets
GSE13574	Mouse heart cells' gene expression difference compared with that of MEF cells
GSE13575	Mouse lung cells' gene expression difference compared with that of MEF cells
GSE13772	The apoA-I induced transcriptome and dependence on MyD88
GSE14216	WT vs Hypomethylated Forebrain Gene Expression
GSE14293	Transcriptome analysis of J774A.1 macrophages undergoing amino acid deprivation
GSE14339	Stress-dependent CHIP/Daxx interaction suppresses the p53 apoptotic program
GSE14512	Muscle Ring Finger 1 (MuRF1) and MuRF2 are Necessary but Functionally Redundant During Developmental Cardiac Growth and Regulate E2F1-Mediated Gene Expression In Vivo
GSE14594	Single intestinal stem cells build crypt-villus structures in vitro without a cellular niche
GSE14644	IL-4-primed bone marrow macrophages isolated from C57Bl6/J or Balb/cAnNCrl mice
GSE14850	Microarray analysis of splenic reservoir monocytes and their blood counterparts
GSE14921	Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism
GSE14971	Comparative gene expression profile of Cux2 knock-out cortex
GSE15056	Expression profiling of laser-microdissected tissue from Tg2576 plaque-depositing mouse model of Alzheimer's disease
GSE15058	Expression profiling of laser-microdissected tissue from APPPS1 plaque-depositing mouse model of Alzheimer's disease
GSE15087	Comparison of gene expression in BMDCs stimulated with gamma-PGA nanoparticles, LPS and unparticulate gamma-PGA
GSE15089	Time-course of gene expression in BMDCs stimulated with gamma-PGA nanoparticles
GSE15128	Laser-microdissected tissue from Tg2576 and APPPS1 plaque-depositing mouse model of Alzheimer's disease
GSE15196	Acetylation of p65 at lysine 314 is important for late NF-k(kappa)B-dependent gene expression
GSE15753	Gene expression in GLN versus PDLN in NOD mice
GSE15784	Lymphoid tissue specific homing of bone marrow-derived dendritic cells
GSE17774	Gene profile of dystrophic cardiac progenitor cells
GSE17914	IL13 and CCL2 Drive Disease in an Inflammatory Subset of Scleroderma [cGVHD]
GSE18168	Uterine gene profiles from WT, KIKO (DNA-binding deficient ERα) and aERKO mice treated with estradiol or xenoestrogens
GSE18170	Double-Stranded RNA-Activated Protein Kinase Regulates early innate immune responses during RSV Infection
GSE18172	T.F. Glis3: a novel critical player in the regulation of pancreatic beta-cell development and insulin gene expression
GSE18246	Gene expression changes induced by the human aristolochic acid I in renal and hepatic tissue of mice
GSE18772	Mouse ES cell neural differentiation
GSE18863	KIAA1718 is a dual specific histone demethylase involved in early neural development
GSE19011	Roles of mammalian Rap1 in TERT recruitment to chromatin, subtelomeric gene silencing and transcriptional regulation
GSE19148	Interferon-γ-responsive non-hematopoietic cells regulate the immune response to Mycobacterium tuberculosis
GSE19360	Integrated array-CGH and expression microarray analyses on medulloblastomas in heterozygous Ptch1 mice, expression
GSE19384	Integrated array-CGH and expression microarray analyses on medulloblastomas in heterozygous Ptch1 mice
GSE19506	Comparison of murine colonic mucosal gene expression between postanatal day 90 (P90) to postnatal day 30 (P30)
GSE19563	Gene expression response to silica treatment in wild-type C57 black 6 mice vs Rag1 knockout, NK-depleted mice
GSE19896	Diabetic db/db mice treated with three doses of rosiglitazone and S compound
GSE19967	Gene Expression Profiling of siRNA Knock-Down of Six1, Six4 and Myogenin in C2C12
GSE19968	Gene Expression Profiling of C2C12 Myoblast Differentiation
GSE19988	Six1 and Six4 function in myoblast differentiation
GSE20052	Gene expression in the liver of ethanol-treated mice via gastric tube in multiple strains
GSE20434	A Pathobiont of the Microbiota Balances Host Colonization and Intestinal Inflammation
GSE20913	CD44+ or CD44– tumor cells isolated from K19-Wnt1/C2mE mice
GSE21027	TGFb dependent Treg conversion and the inhibition of conversion by IL6
GSE21093	Microarray Profile of Gene Expression during Osteoclast Differentiation in Modeled Microgravity
GSE21149	Mycobacterium bovis-BCG vaccination induces a specific pulmonary transcriptome biosignature in mice
GSE21294	FGF2-regulated gene expression in cultured mouse spermatogonial stem cells
GSE21512	Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities
GSE21688	Transcript profiling of individual twin blastomeres derived by splitting 2-cell stage murine embryos
GSE21895	Analysis of TLR4 induced transcriptional responses in interleukin 4 primed mouse macrophages
GSE21978	A global network of transcription factors, involving E2A, EBF1 and FOXO1, that orchestrates the B cell fate
GSE22130	Bone Marrow Derived Mesenchymal Stem Cells Incorporate Into the Prostate During Regrowth
GSE22565	Gene expression in wild type and mENT1 knock out mice
GSE22690	The intracellular domain of amyloid precursor protein induces the dynamic change of the gene expression profile in P19 cells.
GSE22828	Atlas of Gene Expression at Microanatomical Resolution of the Submandibular Salivary Gland
GSE23116	Microarray analysis of gene expression in ATM-deficient MEFs
GSE23181	Impeding Xist expression from the active X chromosome improves mouse somatic cell cloning
GSE23242	Analysis of TLS activity in PGC-1alpha+/+ and PGC-1alpha-/- hepatocytes
GSE23365	Microarray skeletal muscle PGC-1alpha-/- - beta f/f/Mlc1fCre mice
GSE23435	Gene expression data from AKT induced salivary gland tumors
GSE23508	Suppressor of cytokine signaling-1 influences bacterial clearance and pathology during the infection with Mycobacterium tuberculosis
GSE23530	WT vs Hypomethylated DRG Gene Expression
GSE23620	Mechanisms Establishing TLR4-Responsive Activation States of Inflammatory Response Genes (Agilent expression data)
GSE23622	Mechanisms Establishing TLR4-Responsive Activation States of Inflammatory Response Genes
GSE23717	Purified mesenchymal stem cells are an efficient source for iPS cell induction
GSE23793	Gene expression profile of Foxp3 expressing naturally ocurring regulatory macrophages from mice
GSE24209	Effect of pressure overload on cardiac gene expression in wild-type and CHIP(-/-) mice
GSE24218	The Role of Nogo in asthma pathogenesis
GSE24278	The effect of trichloroethylene on gene expression in mouse liver
GSE24410	IL13 and CCL2 Drive Disease in an Inflammatory Subset of Scleroderma
GSE24462	Murine bone marrow-derived mast cells (BMMCs) transduced with pAPM lentiviruses overexpressing miR-221 vs control overexpressing miR-221m.
GSE24851	The gene expression in the skeletal muscle affected by TBP-2/Txnip deficiency
GSE25498	Effect of Exportin-5 expression on Mouse fibroblasts in cell cycle re-entry phase
GSE25536	Expression profiling in primary embryonic fibroblasts deficient for the lats2 locus
GSE25680	Gene expression profile of calcium mediated prevention of colorectal cancer in a mouse model
GSE25702	Rap1a GTPase mVSM Knockout vs. Rescue mRNA Expression
GSE25703	Rap1a GTPase mVSM Knockout vs. Rescue Expression
GSE25770	Gene expression in astrocytes upon sustained GSK-3 inhibition by small molecule
GSE25858	Gene expression profile of butyrate mediated prevention of coloractal cancer in a mouse model
GSE25868	Identification of Hoxa1 downstream targets
GSE25934	Proliferation of mouse thyroid cells after partial thyroidectomy
GSE26429	Promotion of Direct Reprogramming by Glis1
GSE26430	Effect of Glis1, Dmrtb1, and Pitx2 on mouse iPS cell generation
GSE26431	iPS cell generation
GSE26489	Gene expression under normoxia and hypoxia in mouse embryonic fibroblasts
GSE26681	Gestational high salt stressed Embryonic Day 14.5 BdkrB2 Null Mouse Kidney vs. BdkrB2 Wild Type Mouse Kidney
GSE26851	The codon 72 polymorphism of p53 regulates interactions with NF-κB and transactivation of genes involoved in immunity and inflamation
GSE27213	High-fat dietary restriction in mice induces substrate efficiency and improves metabolic health
GSE27340	Development of gene expression signatures on immunity for bursal peptide BSP-II
GSE27457	Effect of dietary cholesterol on gene expression in the liver of apoE-KO mice
GSE27522	Gene expression in Tcf4Het ApcHet mouse colon tumors compared to normal colon
GSE27540	MMTV tumor and host cells
GSE27784	Transcriptional profiling of ATP-competitive mTOR inhibitors reveals mTORC1 and mTORC2 specific regulatory networks
GSE28086	Glucosylceramide fed mice skin before SDS treatment (0d), after SDS treatment (2d)
GSE28145	Effect of ECAT11 disruption in mouse ESCs
GSE28165	Novel age related alterations revealed by a comparative kinetic transcriptome analysis of naïve CD4+ and CD8+ T cells from young and old animals.
GSE28168	Differential gene expression in the airway epithelium of beta6 ko mice chronically challenged with OVA
GSE28198	Gene Expression Analysis of Transgenic Myc-Driven Liver Tumor Formation and Regression
GSE28226	Altered gene expression in the mouse heart after 2-day fasting
GSE28629	De novo DNA methylation by Dnmt3a and Dnmt3b is dispensable for nuclear reprogramming of somatic cells to a pluripotent state
GSE28670	Identification of Sox9-Regulated Pathways During the Secondary Transition Stage of Pancreas Development
GSE28671	Identification of Sox9-Regulated Pathways During Pancreas Development
GSE28696	Development of gene expression signatures on immunity for bursal peptide BPP-II
GSE29152	Lymph node stromal cells: Control siRNA treated vs. Eif4g3 siRNA treated
GSE29153	Differential gene expression in the Pancreatic lymph node of Deaf1 knockout mice vs. wild type littermate controls
GSE29167	Role of Eif4g3 and Deaf1 in Lymph node
GSE29441	Uniform, integration-free iPS cells with a safeguard system using human artificial chromosome vectors
GSE29541	Mice with targeted deletion of Nxf7, the murine ortholog of the clinically implicated NXF5, display impaired hippocampal learning and neuroplasticity
GSE29701	Expression profile of WT and IKKb(EE)IEC epithelial cells (IEC)
GSE29715	mRNA expression data from mice infected with H. pylori treated with estradiol, tamoxifen, or placebo
GSE29725	Global gene expression analysis for mouse embryonic fibroblasts (MEFs), induced hepatocyte-like (iHep) cells and adult mouse hepatocytes.
GSE29744	Translational control in early adipogenesis
GSE30139	Role of Per2 in the control of liver glycogen metabolism
GSE30167	Gene Expression Profiles of Jaw and Alveolar Bones Are Uniquely Different from Those of Trunk and Limb Bones
GSE30506	Response to Influenza infection in the pre-CC
GSE30525	miRNA-29 regulation of gene expression in helper T cells
GSE30577	Gene Expression Analysis of Host Innate Immune Responses in the Brain and Spinal cord following Lethal CVS-11 Infection in Mice
GSE30628	Gene expression analysis of ER-stressed growth plate chondrocytes in two mouse models of Schmid chondrodysplasia
GSE30742	Transcription profile of primordium gut organs
GSE30816	CDK8 and MED12 knockdown in R1 mouse ES cells
GSE30817	CDK8 knockdown in HT-29 cells and CDK8 & MED12 knockdown in R1 cells
GSE30824	Meis1 deficiency effect on thymic epithelial cells
GSE30825	Transcriptional signatures of thymic epithelial cells with distinct Meis1 expression levels
GSE30826	The role of Meis1 in the maintenance of postnatal thymic epithelial cells
GSE30960	Expression analysis of pre-phenotype dt27J mouse dorsal root ganglia
GSE31008	A key role for Mbd3 in 5-hydroxymethylcytosine-dependent gene regulation in embryonic stem cells
GSE31175	Beta 1 blockers improve survival and provide cardioprotection in septic mice
GSE31273	Gene expression arrays for different dendritic cell subset
GSE31319	Murine Myoblast C2C12 Cells: Control vs. Mybbp1a Knockdown
GSE31321	AngII-regulated genes sensitive to CsA in Vascular Smooth muscle cells.
GSE31328	A genome-wide expression profile of steroidogenic cells selectively isolated from adrenal glands of knockout mice lacking steroidogenic acute regulatory protein
GSE31581	ECAT15-2/Dppa2 deficient ESCs
GSE31582	ECAT15-2/Dppa2 transgenic rescue into ECAT15-2/Dppa2 deficient ESCs
GSE31583	Lung of ECAT15-2/Dppa2 deficient embryo at E18.5
GSE31584	Role of ECAT15-2/Dppa2 in lung development
GSE31596	Vitamin C Promotes Positive Selection of Mouse T Cells
GSE31606	Hippocampal gene network analysis to determine the effects of coral calcium hydride in an experimental model of accelerated senescence
GSE32013	Downstream targets of Fgfrl1 signaling
GSE32096	Gene expression in Rspo2 and/or Wnt3a treated C57MG mouse mammary epithelial cells
GSE32116	ARID-DNA interactions are required for promoter occupancy by SWI/SNF
GSE32137	The response of murine primary airway epithelial cells to Influenza infection and the importance of Interferon type I signaling in this response [mAEC].
GSE32140	The response of PBMCs and primary airway epithelial cells to Influenza and RSV virus
GSE32152	Mammary Tissue: Wild type mammary glands vs IGF-IR induced mammary tumors vs IGF-IR independent tumors
GSE32224	Comparison of gene expression in Wild type and T cell-specific conditional Trim28 KO in TCR stimulated and un-stimulated naive CD4 positive and T regulatory cells
GSE32234	A unique role of Cohesin-SA1 in gene regulation and development [Expression]
GSE32320	A unique role of Cohesin-SA1 in gene regulation and development
GSE32364	Murine blood monocyte subsets
GSE32392	Regulation of Monocyte Functional Heterogeneity by miR-146a
GSE32410	Class IA PI3Kinase regulatory subunit p85α regulates mast cell growth and survival related genes
GSE32415	Mouse lung tumor tissue: Dnmt3a KO vs. Dnmt3a WT
GSE32421	NOD2-dependent licensing of the microbiota predispose to transmissible inflammation and tumorigenesis in the colon.
GSE32487	Gene expression and DNA methylation of lung tumors in Dnmt3a deficient vs. WT mice
GSE32511	Gene expression in mouse Lhx2 knock out embryo (E16.5) vs FVB controls
GSE32690	IFN-γ-induced iNOS expression in regulatory macrophages prolongs allograft graft survival in fully immunocompetent recipients.
GSE33057	STAT1 independent control of a neurotropic measles virus challenge in primary neurons and infected mice
GSE33058	Transcriptional profiling of disease progression in bovine tuberculosis and the identification of potential diagnostic biomarkers
GSE33172	Identifying radiation exposure biomarkers from mouse blood transcriptome
GSE33208	RNAi-mediated knockdown of Xist can rescue the impaired postimplantation development of cloned mouse embryo
GSE33280	Gene regulation in hematopoietic cells by Pcgf1 in a Runx1 null background
GSE33317	Gene expression profiling of mouse prostate stem cells
GSE33512	Gene expression data on lungs of wild-type and Rora (Retinoic acid related orphan receptor) mutant mice exposed to room air and smoke
GSE33647	Early Peroxisome proliferator-activated receptor gamma regulated genes involved in expansion of pancreatic beta cell mass
GSE33696	The induction of integrin beta3 signaling in hematopoietic stem cells (HSCs)
GSE33765	Leishmania major infected WT and miR-223 KO mice
GSE33901	The Role of the E2F1 transcription factor in the innate immune response to systemic LPS [mRNA]
GSE33902	The Role of the E2F1 transcription factor in the innate immune response to systemic LPS
GSE33914	GM-CSF cultured WT and miR-223 KO bone marrow
GSE33917	Immature granulocyte in WT and miR-223 KO bone marrow
GSE33924	Granulocyte and Monocyte
GSE33956	miR-233 and bone marrow cells
GSE34238	C2C12 murine myoblast cell line and 48 h 10 uM BIO treated C2C12 cellulate
GSE34278	Whole esophagi of WT, Nrf2-/- and Keap1-/- mice on C57BL background at E11.5, E15.5, P0 and P7, and esophageal epithelium of adult (8 weeks old) mice
GSE34292	Runx1 is a tumor suppressor gene in the mouse gastrointestinal tract
GSE34513	Gene expression profiling of side population cells of mouse thyroid before and after partial thyroidectomy
GSE34581	Comparison of Hepatocyte nuclear factor 4 alpha developmental and temporal knockout mice
GSE34605	Inferring rules of lineage commitment in haematopoiesis
GSE34621	Gene expression profiling of CD4+CD25+Foxp3+ regulatory T cells and CD4+CD25-Foxp3- T cells in the course of Plasmodium yoelii infection of BALB/c mice
GSE34675	Gene Expression from diabetic ischemic limbs in WT and p75KO mice
GSE35588	Effect of obestatin, its N-terminal fragment and fragment analog Nt8U on mice epididymal tissue
GSE35651	Gene expression profile of ATF6a and ATF6b knockout mice with dextran sulfate sodium (DSS)-induced colitis
GSE35795	Urinary bladder in constant darkness: time course
GSE35802	Death Receptors DR6 and TROY Regulate Brain Vascular Development
GSE35933	Molecular signatures associated with Mx1-mediated resistance to highly pathogenic influenza virus infection: mechanisms of survival
GSE35940	A single N66S mutation in the PB1-F2 protein of influenza A virus increases virulence by inhibiting the early interferon response in vivo
GSE35943	Functional genomics of central nervous system and liver following herpes simplex virus corneal infection.
GSE36016	Transcriptomic analysis of host response to mouse-adapted SARS virus in wild type, STAT1 -/-, and IFNAR1 -/- mouse genetic backgrounds
GSE36050	Primary murine embryonic fibroblasts (MEFs): Cdk7 wild type versus Cdk7 KO
GSE36061	Microarray analysis to identify genes that are differentially expressed in resting and in LPS-activated splenic B cells of Ebf1+/fl-RERTCre and Ebf1fl/fl-RERTCre mice
GSE36328	IM002, IM009 - Implication of inflammatory macrophages, nuclear receptors and interferon regulatory factors in increased virulence of pandemic 2009 H1N1 influenza A virus after host adaptation
GSE36408	Gene expression profiling of the whole mouse brain using transcriptome tomography
GSE36412	Liver gene expression signatures for type 2 diabetic mice and normal mice
GSE36481	NOD2 transmissible microbiota predispose WT mice to inflammation
GSE36554	Identification of a new pathway for Th1 cell development induced by cooperative stimulation with IL-4 and TGFbeta [Agilent]
GSE36556	Identification of a new pathway for Th1 cell development induced by cooperative stimulation with IL-4 and TGFbeta
GSE36904	ATF3 links host adaptive-response to breast cancer metastasis
GSE36969	Global gene expression in response to SARS mouse adapted variants MA-15, MA-15epsilon, and MA-15-gamma in young and aged mice
GSE37011	HF liver: Control vs. Plin2-ASO treated
GSE37062	Murine Spermatogonial Stem Cells: Rapamycin- vs Vehicle-exposed in vivo (2-wk treatment)
GSE37289	In Vivo Organ Regeneration via Stroma-Dependent Adult Lineage Reprogramming (mRNA)
GSE37309	In Vivo Organ Regeneration via Stroma-Dependent Adult Lineage Reprogramming
GSE37569	CA04M001 - Virus Dose and Time Response
GSE37572	IM004 - mouse infection with HA avirulent mutation in A/Vietnam/1203-CIP048_RG1/2004(H5N1)
GSE37597	Cardiomyocyte-specific Nitric Oxide Synthase 3 Overexpression in Pressure-Overloaded Left Ventricle.
GSE37665	The effect of alpha, beta, gamma interferon receptors on host reponse to influenza virus in mouse embryonic fibroblasts
GSE37669	Murine CD8+ T cells: in vitro-derived vs. thymocytes
GSE37716	Gene expression of mouse embryonic gonad
GSE37718	Nanos2-associated mRNAs in the embryonic male gonad
GSE37720	Role of Nanos2 in the embryonic male gonad
GSE37857	Murine forestomach epithelial sheets: Controls vs. Sox2 overexpression mutants
GSE37958	Microarray analysis of gene expression in mouse embryonic fibroblasts (MEFs) by addition of serum from L/MDR irradiated mice at 10 and 20 days.
GSE38014	Pulmonary innate immune response to ozone and TLR2 agonist Pam3CYS in C57BL/6 mice
GSE38083	Hepatic transcriptome in wild-type and LXR-deficient mice
GSE38112	An overlapping protein-coding region in Influenza A Virus Segment 3 modulates the host response
GSE38294	Gene expression of mouse embryonic gonad [Nanos2_Stra8]
GSE38297	Gene expression of mouse embryonic gonad [Nanos3]
GSE38299	Gene expression of mouse embryonic gonad [Cyp26b1_Stra8]
GSE38300	Gene expression of mouse embryonic gonad [wild type male]
GSE38301	Gene expression of mouse embryonic gonad [Cyp26b1]
GSE38317	Role of Cyp26b1 in the embryonic male gonad
GSE38325	Transcriptomic profiling of regulatory effects of quercetin and resveratrol supplementation in high fat diet fed mice
GSE38830	Conditional keratinocyte-specific ADAM17 knockout in mice alters skin homeostasis
GSE38954	Epstein-Barr virus LMP1 and LMP2A transgenic B lymphocytes and lymphoma cells
GSE39173	ECM-dependent gene expression in normal and tumor-derived mammary organoids
GSE39249	Primary Mammary Epithelial Cells: Control vs 1023-Treated
GSE39259	Global gene expression in response to West Nile virus in mouse spleen and liver
GSE39260	Gene expression analysis during reprogramming with sequential infecion of Oct4/Klf4/cMyc/Sox2
GSE39408	Lymph node stromal cells: Control siRNA treated vs. Eif4g3 siRNA treated - Total RNA and Heavy polysome fraction
GSE39548	Transcriptome Analysis of Renal Ischemia/Reperfusion Injury and its Modulation by Ischemic Pre-Conditioning or Hemin treatment
GSE39551	Gene expression profiles of adult neural stem cells with loss-of-function and gain-of-function of SIRT1
GSE39629	Esophageal epithelium of 12 weeks old mice (WT, Nrf2-/-) on C57BL background with or without gastroesophageal reflux for 4 weeks.
GSE39699	gene expression signatures of Akt1 +/- mice at 8weeks and 35weeks
GSE39724	Gene expression analysis of iTregs and nTregs
GSE39759	Traumatic Brain Injury Induces Macrophage Subsets In The Brain
GSE39854	Expression data from mouse embryonic stem cells and ES cell-derived definitive endoderm and early hepatic cells
GSE40001	Targeting PyMT oncogene to diverse mammary cell populations enhances tumor heterogeneity and generates rare breast cancer subtypes
GSE40027	GM-CSF cultured and LPS stimulated WT and miR-155 KO DC
GSE40029	Kinetics of M-CSF cultured and LPS stimulated WT and miR-155 KO Macrophages.
GSE40091	Comparative transcriptomic analysis of acute host responses during 2009 pandemic H1N1 influenza infection in mouse, macaque, and swine (mouse dataset)
GSE40092	Comparative transcriptomic analysis of acute host responses during 2009 pandemic H1N1 influenza infection in mouse, macaque, and swine
GSE40265	Oncogenic alterations in multiple core signaling pathways are required for glioblastoma pathogenesis in vitro and in vivo
GSE40332	Gene expression profiles in wild-type and Jmjd3-/- embryos
GSE40483	A genomic regulatory element that directs assembly and function of immunespecific AP-1-IRF complexes
GSE40726	Transcriptional profiling of IRF4 -/- vs IRF4 +/- T-cells under Th17 polarizing conditions
GSE40792	IM010 - Infection with A/Vietnam/1203/04 H5N1 influenza virus of C57BL/6J mice, IDO1 KO mice or TNFRSF1B KO mice
GSE40824	SM019 - Infection with SARS MA15 of C57BL/6J mice and Tnfrsf1b knockout mice
GSE40827	SM020 - Infection with SARS MA15 of C57BL/6J mice and KEPI (ppp1r14c) knockouts
GSE40840	SM015 - Infection with SARS MA15 of C57BL/6J mice and Tnfrsf1a/1b knockouts
GSE40983	BMPER regulates cardiomyocyte size and vessel density in vivo
GSE41041	Pulmonary retention of titanium dioxide nanoparticles and biological outcomes following low dose instillation in mice
GSE41126	Expression data of lungs of mice infected with two highly pathogenic avian influenza viruses
GSE41419	Lipoic acid prevents Cr6+ induced cell transformation and the associated genomic dysregulation.
GSE41449	Epigenetic regulation of gene expression is instructed by promoter sequence and refined by developmental progression [expression]
GSE41450	Epigenetic regulation of gene expression is instructed by promoter sequence and refined by developmental progression.
GSE41645	Gene expression changes in primary Sertoli cells treated with MEK1/2 inhibitor
GSE41877	Transcriptional analysis of genes regulating the mitochondrial dNTP pool in muscle cells.
GSE42131	A novel small compound SH-2251 suppresses Th2 cell-dependent airway inflammation through selective modulation of chromatin status at the Il5 gene locus
GSE42759	Analyses of lung early responses to RSV in the neonatal environment reveal key roles for DC and type I IFN in controlling immunopathologic imprinting.
GSE42760	The microRNA cluster miR-17~92 promotes TFH cell differentiation and represses subset-inappropriate gene expression
GSE42770	Chronic alcohol consumption from adolescence-to-adulthood in mice — Effect on gene expression in the hypothalamus
GSE43101	Gain and loss of H4K16 acetylation during ES cell differentiation [Agilent arrays]
GSE43103	H4K16 acetylation marks active genes and enhancers of embryonic stem cells, but does not alter chromatin compaction
GSE43156	ERK activation, gene dysregulations and cell transformation at submicromolar doses of Cr6+ in C3H10T1/2 and BALB/c 3T3 cells: interaction with Lipoic acid
GSE43301	IM005 - Mouse infection with PB2-627E: A/Vietnam/1203-CIP048_RG2/2004 (H5N1)
GSE43302	IM006A - Mouse infection with PB1-F2del: A/Vietnam/1203-CIP048_RG3/2004 (H5N1) at 10^3 PFU
GSE43337	Impaired neutrophil recruitment in CXCL5 knockout mice during Mtb infection
GSE43405	Identifying vitamin C and RA-regulated genes in the J1 mESCs
GSE43476	Genomic Reprogramming Errors Do Not Accumulate with Serial Recloning in the Mouse
GSE43566	Biomarkers of residual disease, disseminated tumor cells, and metastases in the MMTV-PyMT breast cancer model
GSE43585	Expression profiles of bone marrow cells from model mice for erythropoietin-deficiency anemia (ISAM)
GSE43599	Posterior Second Heart Field (pSHF) Transcriptomes of Wild-type and Tbx5 Mutant Mouse Embryos
GSE43610	Dual Roles of the Transcription Factor Grainyhead-like 2 (GRHL2) in Breast Cancer
GSE43633	Acute hepatic transcriptional response in male mice following oral exposure to benzo(a)pyrene
GSE43781	The differentiation stage of p53- and Rb-deficient bone marrow mesenchymal stem cells imposes the phenotype of in vivo sarcoma development (part I)
GSE43804	The differentiation stage of p53- and Rb-deficient bone marrow mesenchymal stem cells imposes the phenotype of in vivo sarcoma development
GSE43842	Gene expression profile in livers from control or Wy-14643 treated MycF/F or MycF/F,ERT2-Cre mice
GSE43873	Focal Adhesion Kinase Dependent Expression
GSE43910	Mouse gene expression profile after transfected with miR-27a mimics and mimic NC in Raw
GSE43932	Commensal microbiota contributes to chronic endocarditis and arrhythmia in TAX1BP1 deficient mice.
GSE44059	Gene expression of adipocyte and stromal-vascular fractions
GSE44237	Gene expression changes in liver tissues from alcohol treated mice
GSE44320	Francisella tularensis subsp. tularensis Induces a Unique Pulmonary Inflammatory Response: Role of Bacterial Gene Expression in Temporal Regulation of Host Defense Responses
GSE44441	IM006B - Mouse infection with A/Vietnam/1203-CIP048_RG3/2004 (H5N1)
GSE44445	IM007 - Mouse infection with A/Vietnam/1203-CIP048_RG4/2004 (H5N1)
GSE44595	Role for HA and the viral RNA polymerase complex in the virulence of the 1918 influenza virus
GSE44603	A global toxicogenomic analysis investigating the mechanistic differences between tobacco and marijuana smoke condensates in vitro
GSE44695	GR and Klf15 regulate gene expression dynamics and integrate signals through feed forward circuitry
GSE44754	Posterior Second Heart Field (pSHF) transcriptomes of wild-type and Shh mutant mouse embryos
GSE44756	Hedgehog Molecular Networks in the Second Heart Field
GSE44803	Gene expression in mouse leukocytes after CAWS administration
GSE44904	mRNAs and miRNAs expression data from AOM/DSS, AOM, DSS and control mouse colon epithelial tissue at day100 when tumor formed in AOM/DSS bearing mice --- mRNA expression data
GSE44937	Defining a Th9 transcriptome
GSE44980	Effects of group III phospholipase A2 deficiency in mast cells on fibroblast-directed maturation of mast cells in vitro
GSE44986	Gene Regulation in Bob1-/- and miR-146a-/- Murine Pre-B Cells
GSE44988	mRNAs and miRNAs expression data from AOM/DSS, AOM, DSS and control mouse colon epithelial tissue at day100 when tumor formed in AOM/DSS bearing mice
GSE45035	Brain transcriptome profiles in mouse model simulating features of post-traumatic stress disorder
GSE45166	Transcriptome profiling of the newborn mouse lung response to acute ozone exposure
GSE45304	Transcriptional profiles of kidneys that underwent reversible UUO model using model mice for erythropoietin-deficiency anemia (ISAM)
GSE45424	Gene expression analysis to identify Runx1 target genes in B-cell progenitors
GSE45425	Runx1 targets in early B-cell progenitors
GSE45482	Genes affected by PAD4 deficiency in LSK cells obtained from mouse bone marrow.
GSE45842	Expression profiles of mouse NK cell subsets
GSE45844	Six2CrefSall1 E14.5 WTvsKO, Sall1CreERfSall1 E14.5 WTvsKO 100120
GSE45845	Sall1 co-operated with Six2 to actively maintain nephron progenitors in the embryonic kidney
GSE45897	Gene expression in the islets of 12 wk old Non-Obese Diabetic (NOD) mice and healthy control NOD.B10 mice
GSE46000	Transcriptional profiling of 2D colonies derived from WT, Bmi1-/-, and Bmi1-/-;Ink4a/Arf Labial cervical loops
GSE46001	Bmi1
GSE46200	LGR5 positivity defines stem-like cells in colorectal cancer [Expression]
GSE46335	Coxiella burnetii, the agent of Q fever, persists in adipocytes
GSE46438	Expression profiling of CD24+ and CD24- tumor cells in Kras-driven NSCLC mouse model
GSE46439	Expression profiling of lung adenocarcinoma TPC tumor cells in Kras-driven NSCLC mouse model
GSE46533	Cytosolic Phospholipase A2α and Eicosanoids Regulate Expression of Genes in Macrophages Involved in Host Defense and Inflammation
GSE46712	LGR5 positivity defines stem-like cells in colorectal cancer
GSE46843	Obesity primes the enhancer landscape of colon epithelium for cancer
GSE46933	Role of omega-3 fatty acids regulating the brain functions and associated disorders: Transcriptomic analysis of the effect of a fish oil enriched diet on murine brains
GSE47417	∆Np63 regulates stem cell activity in mammary gland development
GSE47419	Transcriptome profiles of mouse mammary stem cells and progenitor cells
GSE47486	subventricular zone progenitors healthy vs. Experimental Autoimmune Encephalomyelitis mice
GSE47487	Gene regulation during colitis-associated colon cancer in Muc1 hematopoietic KO chimeric mice
GSE47493	ΔNp63 promotes stem cell activity in mammary gland development and basal-like breast cancer by enhancing Fzd7 expression and Wnt signaling
GSE47663	Age dependence of hematopoietic progenitor survival and chemokine family gene induction after gamma-irradiation in bone marrow tissue in C3H mice
GSE47844	Temporal examination of Clofibrate and WY-14,643 elicited gene expression in C57BL/6 mice
GSE47931	Gene expression of mice over-expressing secretoglobin 3A2 in lung
GSE48329	Interleukin-17 mediated paracrine network promote tumor resistance to anti-angiogenic therapy
GSE48370	The pluripotency factor NANOG regulates the mitotic program of adult stratified epithelia.
GSE48486	Reprogramming fibroblasts into bi-potential hepatic stem cells by defined factors
GSE49171	Comparative gene expression analyses using post-implanted E6.5 cloned embryos
GSE49172	Comparative gene expression analyses using E4.0 cloned blastocysts
GSE49173	Donor cell type-specific gene expression in embryonic but not extraembryonic tissues of postimplantation embryos cloned from somatic cells
GSE49195	Gene expression profiling of liver tissue from lean (WT) and obese (ob/ob) mice following a chronic exposure of low doses of pharmaceuticals
GSE49262	SM012 - SARS MA15 wild type, and SARS deltaORF6 mutant virus infections of C57BL6 mice - A time course
GSE49263	SM014 - SARS MA15 wild type, and SARS nsp16 mutant virus infections of C57BL6 mice - A time course
GSE49265	Progression from low- to high-grade astrocytoma is characterized by transcriptomal heterogeneity and genomic number copy alterations (part 1)
GSE49269	Progression from low- to high-grade astrocytoma is characterized by transcriptomal heterogeneity and genomic number copy alterations
GSE49380	Whole genome expression analysis of tumor regulatory T cells expressing interleukin-10
GSE49441	IFN-alpha- and IFN-gamma-regulated transcription in MEFs derived from wild type mice or littermates expressing STAT1F77A
GSE49513	Epigenetic regulation of sex determination by the histone demethylase Jmjd1a
GSE49820	Misregulation of the broad-range phospholipase C activity increases the susceptibility of Listeria monocytogenes to intracellular killing by neutrophils
GSE49826	Gene expression profiling on innervated and denervated muscles of Smad4 KO and control mice.
GSE49968	The Menin-Bach2 axis is critical for regulating CD4 T cell senescence and cytokine homeostasis
GSE49987	Dynamic analysis of gene expression and genome wide transcription factor binding during lineage-specification of multipotent progenitors [TC]
GSE49988	Dynamic analysis of gene expression and genome wide transcription factor binding during lineage-specification of multipotent progenitors [PC]
GSE49989	Dynamic analysis of gene expression and genome wide transcription factor binding during lineage-specification of multipotent progenitors [HP]
GSE49990	Dynamic analysis of gene expression and genome wide transcription factor binding during lineage-specification of multipotent progenitors [ER]
GSE49991	Dynamic analysis of gene expression and genome wide transcription factor binding during lineage-specification of multipotent progenitors
GSE50000	SM003 - icSARS CoV, SARS MA15 wild type and SARS BatSRBD mutant virus infections of C57BL6 mice - A time course
GSE50642	Early gene expression changes in spinal cord from SOD1G93A Amyotrophic Lateral Sclerosis animal model
GSE50878	SM007 - Infection with SARS MA15 of C57BL6/J mice and CXCR3 knockouts in the same strain of mice.
GSE51139	Transcription profile of FBL-knock down ES cells
GSE51386	SM004 - SARS infection of C57BL6, TIMP1 and Serpine1 knock-out mice.
GSE51387	SM009 - SARS infection of C57BL6, and PLAT knock-out mice.
GSE51408	Expression microarray screen for genes regulated by the unliganded glucocorticoid receptor
GSE51526	IM015 - Influenza infection of C57BL6 and RIPK3 knock-out mice
GSE51612	Transcriptome profiling in Engrailed2 knockout mice reveals common molecular pathways associated with ASD.
GSE51935	Identification of renal distal convoluted tubules enriched genes
GSE52424	Gene expression from Prep1-ablated mice
GSE52547	Medullary Thymic Epitherlial Cell (mTEC) Gene Expression in MBD1 WT and KO Mice
GSE52548	Aire co-opts the repressive ATF7ip/MBD1 protein complex for the induction of immune tolerance
GSE52767	Gene expression profiling to identify genes that are differentially expressed between murine MHCIIlo and MHCIIhi dendritic cell subpopulations [LPS stimulation]
GSE52771	Gene expression profiling to identify genes that are differentially expressed between murine MHCIIlo and MHCIIhi dendritic cell subpopulations [MHCIIhi vs. MHCIIlo]
GSE52773	Transcriptional programming of dendritic cells for enhanced major histocompatibility complex class II antigen presentation
GSE52815	Gene expression in the isolated islets of 10 day old, 4 wk old, 12 wk old, and 20 wk old Non-Obese Diabetic (NOD) mice compared to healthy age matched control NOD.B10 mice
GSE53057	Transcriptomic Profiling of Collaborative Cross Founder Mouse Embryonic Fibroblasts stimulated with Type I, II and III Interferons
GSE53136	Thalamus and hypothalamus response to visual input deprivation
GSE53381	Effects of NAFLD/NASH on hepatic gene expression.
GSE53520	Effect of in utero undernutrition on skeletal muscle gene expression
GSE53770	Deregulation of the endogenous C/EBPβ LIP isoform predisposes to tumorigenesis
GSE53972	Gene expression profiles in the liver of obese AIM+/+ and AIM-/- mice
GSE54019	Role of smooth muscle cell autophagy in atherosclerosis
GSE54048	Characterizing the transcriptomic response of mice infected with A/Anhui/01/2013 (H7N9), A/Netherlands/219/2003 (H7N7), and A/Vietnam/1203/2004 (H5N1), and a pandemic H1N1 human virus, A/Mexico/4482/2007 (H1N1)
GSE54089	Testis expression in Mus musculus domesticus WSB/EiJ x Mus musculus musculus PWD/PhJ F2 hybrids
GSE54198	Gene expression profile of neonate mouse epidermis stem cell after transplacental exposure to Arsenic in drinking water
GSE54261	Over-expression of either MECP2_e1 or MECP2_e2 in mouse MECP2 knockout fibroblasts
GSE54276	Transcriptional changes in skeletal muscle in response to 4 weeks of exercise training
GSE54278	Functional consequences of DNA-methylation in response to regular exercise
GSE54708	Regulation of neuronal gene expression and survival by basal NMDA receptor activity: a role for Histone Deacetylase 4
GSE55019	p120-catenin differentially regulates cell migration by Rho-dependent intracellular and secreted signals
GSE55135	Gene expression patterns induced by a transient switch-on of ROS production in mouse skin
GSE55255	A human sleep homeostasis phenotype in mice expressing a primate-specific PER3 variable-number tandem-repeat coding-region polymorphism
GSE55312	Transcription profile of primordium gut organs
GSE55494	Effect of 12 hour sleep restriction on the transcriptome of mice carying a human Per3 polymorphism
GSE55495	Effect of ultradian light-dark cycles on the transcriptome of mice carying a human Per3 polymorphism
GSE55522	Snd1-Mtdh interaction regulates cell survival under camptothecin-induced replication stress
GSE55812	Gene expression in IL-10-deficient and wild-type mice following Citrobacter rodentium infection
GSE56324	Intratracheally Instilled Titanium Dioxide Nanoparticles Translocate to Heart and liver and Activate Complement Cascade in the Heart of C57BL/6 Mice (Heart)
GSE56325	Intratracheally Instilled Titanium Dioxide Nanoparticles Translocate to Heart and liver and Activate Complement Cascade in the Heart of C57BL/6 Mice (Liver)
GSE56433	IM013 - Mouse infection with A/Vietnam/1203/2004 (H5N1)
GSE56571	Gene expression of mouse intestine treated with azoxymethane and/or St. John's wort
GSE56620	Mouse utero-tubular junction (UTJ): 1: females in estrous no mating; 2: females in estrous mated with vasectomized male; 3: females in estrous mated with normal male: 1 vs. 2; 1 vs. 3; 2 vs. 3.
GSE56734	Expression of genes in adult hepatocytes and fetal hepatoblasts
GSE56793	Germ cell sexual differentiation requires Nanos2-mediated repression of Dazl in mice [Set 1]
GSE56794	Germ cell sexual differentiation requires Nanos2-mediated repression of Dazl in mice [Set 2]
GSE56795	Germ cell sexual differentiation requires Nanos2-mediated repression of Dazl in mice
GSE56943	Genes regulated by Gadd45a during somatic cell reprogramming
GSE56944	Genes and miRNAs regulated by Gadd45a during somatic cell reprogramming
GSE57196	Exposure to ionizing radiation induced persistent gene expression changes in mouse mammary gland
GSE57237	Gene expression in the pancreatic lymph nodes (PLN) of hyperglycemic 16-week-old Non-Obese Diabetic (NOD) mice compared to expression the PLN of euglycemic 16-week-old NOD mice.
GSE57304	Gene expression analysis in adoptive T cell immunotherapy (ACT)
GSE57329	Galectin-3 Deficiency Exacerbates Hyperglycemia and the Endothelial Response to Diabetes
GSE57838	4TO7 cells: miR-23b/27b/24 overexpression vs control
GSE57972	Analysis of aortic gene expression in ovariectomized ApoE-deficient mice substituted with medroxyprogesterone acetate, norethisterone acetate or placebo
GSE57976	Epinecidin-1 has immunomodulatory effects, facilitating its therapeutic use in a mouse model of Pseudomonas aeruginosa sepsis
GSE58306	Gene expression changes in mouse pancreatic cancer xenograft induced by exposure to enriched environment
GSE58964	Gene expression levels in Arid1a deficiency mice liver and their littermates
GSE59431	Effect of PML/RARA on the transcriptome of preleukemic early promyelocytes vs PML/RARA-Flt3ITD leukemic promyelocytes
GSE59576	ATM deficiency in the absence of T cells promotes the development of NF-kB-dependent B cell lymphomas [Gene Expression]
GSE59578	ATM deficiency in the absence of T cells promotes the development of NF-kB-dependent B cell lymphomas
GSE59674	The transcriptomic signature of myostatin inhibitory influence on the differentiation of mouse C2C12 myoblasts
GSE59775	Transcriptional analysis of follistatin influence on C2C12 mice myoblasts differentiation
GSE59940	The Nlrp12 inflammasome negatively regulates NOD2-mediated adjuvanticity, endotoxic shock and host defence afforded by an immunomodulatory muropeptide.
GSE60031	Transcriptional profiles of embryonic stem cell derived gastrointestinal tissue.
GSE60595	Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
GSE60797	Transcriptional profiling to identify physical-chemical properties detrimental to nanomaterial-induced pulmonary response (part 1)
GSE60798	Transcriptional profiling to identify physical-chemical properties detrimental to nanomaterial-induced pulmonary response (part 2)
GSE60799	Transcriptional profiling to identify physical-chemical properties detrimental to nanomaterial-induced pulmonary response (part 3)
GSE60800	Transcriptional profiling to identify physical-chemical properties detrimental to nanomaterial-induced pulmonary response (part 4)
GSE60801	Transcriptional profiling to identify physical-chemical properties detrimental to nanomaterial-induced pulmonary response
GSE60804	Epigenetic silencing of SFRP4 contributes to epidermal hyperplasia in psoriasis
GSE61119	Self-renewal of hepatoblasts under chemically defined conditions by reiterative growth factor and chemical screening
GSE61177	Myocardial gene expression in response to pressure overload
GSE61417	Testis expression in Mus musculus domesticus x Mus musculus musculus hybrid zone mice
GSE61728	The Tsk2/+ mouse fibrotic phenotype is due to a gain-of-function mutation in the PIIINP segment of the Col3a1 gene
GSE61807	Nanos2-associated mRNAs in the postnatal testis
GSE61808	Nanos2-regulated mRNAs in the cultured spermatogonial stem cells (SSCs)
GSE61938	Gene Expression in induced Treg cell from CD4+ Naive T cell isolated from miR-31fl/fl/CD4Cre vs Control mice
GSE61948	Transcriptome and cistrome analysis reveals synergistic roles for Sox9 and Pdx1 in lineage allocation of foregut progenitor cells
GSE62023	Identification of Sox9/Pdx1-coregulated Genes During Pancreas Organogenesis
GSE62068	Gene expression in whole mouse E9.0 embryos comparing wt with Arid3b-null embryos
GSE62072	Arid3b is required for heart development
GSE62598	Granulocytic immune infiltrates are essential for the efficient formation of breast cancer liver metastases
GSE62850	RNA-Seq Versus Oligonucleotide Array Assessment of Dose-Dependent TCDD-elicited Hepatic Gene Expression in Mice [Array]
GSE62903	RNA-Seq Versus Oligonucleotide Array Assessment of Dose-Dependent TCDD-elicited Hepatic Gene Expression in Mice
GSE63617	Gene expression profiling of the AD11 anti-NGF transgenic mouse model of neurodegeneration at 1, 3, 6, 15 months of age
GSE63705	Gene regulated by Srebp1 and c-Myc during reprogramming
GSE63786	An ultrasensitive mechanism regulates influenza virus-induced inflammation
GSE63886	Trichostatin A specifically improves the aberrant expression of transcription factor genes in embryos produced by somatic cell nuclear transfer
GSE64045	DosS Is Required for the Complete Virulence of Mycobacterium tuberculosis in Mice with Classical Granulomatous Lesions
GSE64167	Analysis of the lung transcriptome in Mycobacterium tuberculosis-infected mice reveals major differences in immune response pathways between TB-susceptible and resistant hosts.
GSE64287	Role of IL-2 inducible T cell kinase (ITK) and Bruton's tyrosine kinase (BTK) in mast cell response to lipopolysaccharide (LPS)
GSE64453	Transformation of enriched mammary cell populations with Polyoma Middle T Antigen influences tumor subtype and metastatic potential
GSE64648	Genome activity during the emergence of mouse embryonic totipotency (morpholino)
GSE64649	Genome activity during the emergence of mouse embryonic totipotency (time course)
GSE64650	Genome activity during the emergence of mouse embryonic totipotency
GSE64660	Genome Wide Identification of SARS-CoV Susceptibility Loci Using the Collaborative Cross
GSE64715	Specific gene expression related to epiblast development
GSE64956	Gene expression in diabetes-prone (NZO/HiBomDife) and diabetes-resistant (C57BL/6.V-Lepob/ob) mouse strains
GSE65063	Reciprocal interaction of Wnt and RXR-α pathways in hepatocyte development and hepatocellular carcinoma
GSE65083	Bach2 inhibits Th2-type immune responses by regulating glutamine metabolism [expression array]
GSE65084	Bach2-Batf interactions control Th2-type immune responses by regulating the IL-4 amplification loop
GSE65497	Generation of Cloned Mice from Adult Neurons by Direct Nuclear Transfer
GSE65871	Prior infection with Type A Francisella tularensis antagonizes the pulmonary transcriptional response to an aerosolized TLR4 agonist
GSE66026	Gene expression analysis in differentiated day 3 cells from mouse ESC under the treatment of DMSO and histone deacetylase inhibitors (TSA) [expression array]
GSE66027	Expression and epigenetic profiling during mouse ESC neural differentiation
GSE66584	Gene expression profiling in the liver of 3-month old mice with a mutant Wrn protein compared to 3-month old WT mice
GSE66642	Gene expression profiling in the liver of 3-month old mice with a mutant Wrn protein treated with vitamin C compared to 3-month old WT mice
GSE66658	Genome-Wide Gene Expression Profiles in the Pancreatic Lymph Nodes of non-obese diabetic (NOD) mice
GSE67308	Hif2a-cardiomyocyte deficient mice response to myocardial ischemia and reperfusion
GSE67546	Fat-specific protein 27/CIDEC plays an important role in promoting alcoholic liver injury in mice and humans
GSE67675	Gene expression signature for highly liver metastatic colon cancer cell line
GSE68076	Transcriptome profiling of spleen, blood and hemi-brain of social stressed C57B6 mice exhibiting PTSD like features
GSE68077	Transcriptome characterization of social stressed C57B6 mice exhibiting PTSD like features
GSE68143	Glucagon receptor signaling in GCGR KO mice
GSE68145	Glucagon Couples Hepatic Amino Acid Catabolism to mTOR-dependent Regulation of α-cell Mass
GSE68480	MuRF1 regulation of Fenofibrate’s induction of spontaneous cardiac hypertrophy in vivo.
GSE68688	Gene expression profiling in the liver of 3-month old mice with a mutant Wrn protein treated with vitamin C compared to the liver of 3-month old untreated mice with a mutant Wrn protein.
GSE68820	Mouse lung tissue transcriptome response to a mouse-adapted strain of SARS-CoV in wild type C57BL6/NJ mice and TLR3-/- mice
GSE69076	Identification of LPS-responsive genes in bone marrow-derived dendritic cells
GSE69547	Otx2 controls regional patterning within the MGE and regional identity of the septum [Agilent]
GSE69693	Time-course of genes expression of the dorsal and lateral lineage in the SVZ-RMS-OB post-natal neurogenic system
GSE69727	Otx2 controls regional patterning within the MGE and regional identity of the septum
GSE70379	2,3,7,8-Tetrachlorodibenzo-p-Dioxin (TCDD) Alters Lipid Metabolism and Depletes Immune Cell Populations in the Jejunum of C57BL/6 Mice
GSE70445	1918 pandemic influenza virus and pneumococcus co-infection results in activation of coagulation and widespread pulmonary microvascular thrombosis in mice and humans
GSE70502	The 1918 PB2 protein, not HA, enhances the virulence of an avian influenza virus closely related to the 1918 pandemic virus through the inhibition of wnt signaling.
GSE70631	Microarray analysis of gene expression in Dnmt3a-knockdown macrophages.
GSE71263	Nrf2 suppresses macrophage inflammatory response by blocking proinflammatory cytokine transcription
GSE71647	Gene expression change in Keap1 knockdown (KD) mice in kidneys of ischemia-reperfusion injury (IRI)
GSE71693	Murine Kidney Papilla Cells: Control GFP- vs. GFP+ label retaining cells. Cell populations were separated by FACS.
GSE71991	Interspecies Comparative Genomics Identifies Optimal Mouse Models of Scleroderma (Tsk1/+)
GSE71995	Interspecies Comparative Genomics Identifies Optimal Mouse Models of Scleroderma (Tsk2)
GSE71998	Interspecies Comparative Genomics Identifies Optimal Mouse Models of Scleroderma (bleoskin)
GSE71999	Interspecies Comparative Genomics Identifies Optimal Mouse Models of Scleroderma
GSE72347	Molecular Characterization of Spontaneously Transformed Epithelial Murine Colon Cell Lines as a Model of Human Colorectal Neoplasia (expression)
GSE72349	Molecular Characterization of Spontaneously Transformed Epithelial Murine Colon Cell Lines as a Model of Human Colorectal Neoplasia
GSE72449	AhR links air pollution and atopic dermatitis via Artemin induction
GSE72595	Global gene expression profiles of induced lung progenitor (iLung) cells
GSE73286	gene expression analysis in Pbx1; Emx1-cre mutant cortex at embryonic day 12.5
GSE73287	gene expression analysis in Pbx1; Emx1-cre mutant cortex at embryonic day 15.5
GSE73288	gene expression analysis in Pbx1; Emx1-cre mutant cortex at embryonic day
GSE73295	Gene Expression Differences in MYC and RAS Driven Liver Cancer Transgenic
GSE73564	Development of gene expression signatures for mouse macrophages polarization
GSE73567	A network including TGFβ/Smad4, Gata2 and p57 regulates proliferation of mouse hematopoietic stem/progenitor cells [expression]
GSE73612	Gene expression analysis of inositol hexakisphosphate kinase 1 (IP6K1) knockout mouse embryonic fibroblasts
GSE73642	A network including TGFβ/Smad4, Gata2 and p57 regulates proliferation of mouse hematopoietic stem/progenitor cells
GSE73659	Murine chondrocytes: Control vs Ad-Epas1 infected
GSE73759	JNK1 Ablation in Mice Confers Long-term Metabolic Protection from Diet-Induced Obesity at the Cost of Increased Skin Oxidative Damage
GSE73900	Gene Regulation by microRNA-16 forced expression in ErbB-2 positive murine breast cancer cells.
GSE74542	Gene expression in diet-induced obesity resistent (DIO non-responder) and diet-induced obesity susceptible (DIO responder) C57BL/6J mouse strain
... Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here

Relations

Alternative to

GPL4134

Data table header descriptions
ID	Agilent feature number
SPOT_ID	Spot identifier
CONTROL_TYPE	Control type
REFSEQ	RefSeq Accession number
GB_ACC	GenBank Accession number
GENE	Entrez Gene ID
GENE_SYMBOL	Gene Symbol
GENE_NAME	Gene Name
UNIGENE_ID	UnigeneID
ENSEMBL_ID	EnsemblID
TIGR_ID	TIGRID
ACCESSION_STRING	Accession String
CHROMOSOMAL_LOCATION	Chromosomal Location
CYTOBAND	Cytoband
DESCRIPTION	Description
GO_ID	GoIDs
SEQUENCE	Sequence

Data table

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

GENE

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

TIGR_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

A_51_P100021

FALSE

AY454345

16656

Hivep3

human immunodeficiency virus type I enhancer binding protein 3

Mm.302758

gb|AY454345|tc|TC1584815|nap|NAP057482-1

chr4:119807944-119808005

mm|4qD2.1

Mus musculus clone pZAS3 328-2275 zinc finger protein ZAS3 (Krc) mRNA, partial cds; alternatively spliced. [AY454345]

CATGGCTGGATTAACGTATGTGTGTGGTATATAGATACACAGAGAGAAACCAAAGTGGTG

A_51_P100034

FALSE

NM_027162

69674

Mif4gd

MIF4G domain containing

Mm.390387

ref|NM_027162|ref|NM_001243586|ref|NM_001243587|ref|NM_001243584

chr11:115469328-115469269

mm|11qE2

Mus musculus MIF4G domain containing (Mif4gd), transcript variant 1, mRNA [NM_027162]

GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG

A_51_P100052

FALSE

NM_198863

245450

Slitrk2

SLIT and NTRK-like family, member 2

Mm.336081

ENSMUST00000036043

ref|NM_198863|ref|NM_001161431|ens|ENSMUST00000036043|ens|ENSMUST00000166241

chrX:63908145-63908204

mm|XqA7.1

Mus musculus SLIT and NTRK-like family, member 2 (Slitrk2), transcript variant 2, mRNA [NM_198863]

GO:0003674(molecular_function)|GO:0007409(axonogenesis)|GO:0016020(membrane)|GO:0016021(integral to membrane)

CTAAATGTGAATTGCCAAGAAAGGAAGTTCACTAACATCTCTGACCTACAGCCCAAACCT

A_51_P100063

FALSE

NM_010727

16924

Lnx1

ligand of numb-protein X 1

Mm.440403

ref|NM_010727|ref|NM_001159577|ref|NM_001159579|ref|NM_001159580

chr5:74993810-74993386

mm|5qC3.3

Mus musculus ligand of numb-protein X 1 (Lnx1), transcript variant 2, mRNA [NM_010727]

GAAGAATCAGATGTGGTGACATTCTTCTCGCTGTCAACGGTAGAAGTACATCGGGTATGA

A_51_P100084

FALSE

nap|NAP091803-1

unmapped

AAGTCATCTCTCATGCCTATCAGAATACTCTGCCTCTAAGCCCAAATCAACATCTTAAAA

A_51_P100099

FALSE

AK011292

69886

2610002J23Rik

RIKEN cDNA 2610002J23 gene

Mm.391799

gb|AK011292|tc|TC1611660|tc|TC1626427|riken|2610002J23

chr11:100318948-100318889

mm|11qD

Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2610002J23 product:unclassifiable, full insert sequence. [AK011292]

TTTTGTTGTTTTACTTACAGCATATGTTCTGGTGATTGAAAACCAAACAGTTATGGAGGG

A_51_P100155

FALSE

NM_027371

70285

Rpf1

ribosome production factor 1 homolog (S. cerevisiae)

Mm.28128

ENSMUST00000029838

ref|NM_027371|ens|ENSMUST00000029838|gb|AK010079|gb|AK171079

chr3:146170053-146169498

mm|3qH2

Mus musculus ribosome production factor 1 homolog (S. cerevisiae) (Rpf1), transcript variant 2, mRNA [NM_027371]

TACGAAGGGGTCCACAAGCCACGGGAAATGGATACAAGTCGAAGGAAATTCCACTTATAA

A_51_P100174

FALSE

NM_008613

17427

Mns1

meiosis-specific nuclear structural protein 1

Mm.387671

ENSMUST00000034746

ref|NM_008613|ens|ENSMUST00000034746|gb|D14849|gb|AK132772

chr9:72306274-72306333

mm|9qD

Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA [NM_008613]

CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT

A_51_P100181

FALSE

NM_001048208

26896

Med14

mediator complex subunit 14

Mm.17616

ENSMUST00000096495

ref|NM_001048208|ens|ENSMUST00000096495|gb|AK136576|riken|9130409M07

chrX:12253601-12253542

mm|XqA1.1

Mus musculus mediator complex subunit 14 (Med14), transcript variant 1, mRNA [NM_001048208]

GO:0001104(RNA polymerase II transcription cofactor activity)|GO:0003712(transcription cofactor activity)|GO:0003713(transcription coactivator activity)|GO:0004872(receptor activity)|GO:0005634(nucleus)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006357(regulation of transcription from RNA polymerase II promoter)|GO:0006367(transcription initiation from RNA polymerase II promoter)|GO:0016592(mediator complex)|GO:0030518(intracellular steroid hormone receptor signaling pathway)|GO:0030521(androgen receptor signaling pathway)|GO:0045893(positive regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046966(thyroid hormone receptor binding)

CATCTCAATAGGATTTCTTTTTAAGAGTACTGTACTGTCTCTTGAAGCCAGTCAGGGACT

A_51_P100218

FALSE

NM_134198

171232

Vmn1r234

vomeronasal 1 receptor 234

Mm.377189

ENSMUST00000079633

ref|NM_134198|ens|ENSMUST00000079633|gb|BC127026|tc|NP496264

chr17:21366635-21366694

mm|17qA3.2

Mus musculus vomeronasal 1 receptor 234 (Vmn1r234), mRNA [NM_134198]

TTTAGTTAATCTTACCTGGCATCTAGTGAGTATCCATGCAATATTCTCAATGTGTTTTGC

A_51_P100227

FALSE

NM_023579

70572

Ipo5

importin 5

Mm.221452

ENSMUST00000032898

ref|NM_023579|ens|ENSMUST00000032898|ens|ENSMUST00000164092|gb|AK079134

chr14:121346888-121346947

mm|14qE5

Mus musculus importin 5 (Ipo5), mRNA [NM_023579]

GATCCAAACGTTTTGGCTTAGGATTTCCATTGCAGATTGTAATTGCTTTAGAGACACACG

A_51_P100238

FALSE

NM_146376

258373

Olfr323

olfactory receptor 323

Mm.377463

ENSMUST00000070804

ref|NM_146376|ens|ENSMUST00000070804|gb|BC146611|tc|TC1599732

chr11:58438789-58438730

mm|11qB1.3

Mus musculus olfactory receptor 323 (Olfr323), mRNA [NM_146376]

GGACCATGATCTCCATGTATGTGCGCCCAAATGCACATCTGTCACCGGAACTCAACAAGG

A_51_P100246

FALSE

NM_145578

22192

Ube2m

ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)

Mm.196580

ENSMUST00000131837

ref|NM_145578|ref|NM_001168469|ref|NM_001243968|ens|ENSMUST00000131837

chr7:13621239-13621093

mm|7qA1

Mus musculus ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast) (Ube2m), transcript variant 1, mRNA [NM_145578]

AGTCCTTACGATAAACTCCATAATTTATGGCCTGCAGTATCTCTTCTTGGAGCCGAACCC

A_51_P100289

FALSE

NM_020493

20807

Srf

serum response factor

Mm.45044

ENSMUST00000015749

ref|NM_020493|ens|ENSMUST00000015749|tc|TC1577357|tc|TC1718111

chr17:46683795-46683788

mm|17qC

Mus musculus serum response factor (Srf), mRNA [NM_020493]

GO:0000790(nuclear chromatin)|GO:0001076(RNA polymerase II transcription factor binding transcription factor activity)|GO:0001077(RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001569(patterning of blood vessels)|GO:0001701(in utero embryonic development)|GO:0001707(mesoderm formation)|GO:0001764(neuron migration)|GO:0001829(trophectodermal cell differentiation)|GO:0001947(heart looping)|GO:0002011(morphogenesis of an epithelial sheet)|GO:0002042(cell migration involved in sprouting angiogenesis)|GO:0002521(leukocyte differentiation)|GO:0003677(DNA binding)|GO:0003682(chromatin binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0003705(sequence-specific distal enhancer binding RNA polymerase II transcription factor activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005783(endoplasmic reticulum)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006366(transcription from RNA polymerase II promoter)|GO:0007015(actin filament organization)|GO:0007160(cell-matrix adhesion)|GO:0007275(multicellular organismal development)|GO:0007369(gastrulation)|GO:0007507(heart development)|GO:0007616(long-term memory)|GO:0008134(transcription factor binding)|GO:0008285(negative regulation of cell proliferation)|GO:0008306(associative learning)|GO:0009725(response to hormone stimulus)|GO:0010669(epithelial structure maintenance)|GO:0010735(positive regulation of transcription via serum response element binding)|GO:0010736(serum response element binding)|GO:0016337(cell-cell adhesion)|GO:0021766(hippocampus development)|GO:0022028(tangential migration from the subventricular zone to the olfactory bulb)|GO:0030036(actin cytoskeleton organization)|GO:0030038(contractile actin filament bundle assembly)|GO:0030155(regulation of cell adhesion)|GO:0030168(platelet activation)|GO:0030220(platelet formation)|GO:0030336(negative regulation of cell migration)|GO:0031175(neuron projection development)|GO:0031490(chromatin DNA binding)|GO:0033561(regulation of water loss via skin)|GO:0034097(response to cytokine stimulus)|GO:0035855(megakaryocyte development)|GO:0035912(dorsal aorta morphogenesis)|GO:0042803(protein homodimerization activity)|GO:0043149(stress fiber assembly)|GO:0043565(sequence-specific DNA binding)|GO:0043589(skin morphogenesis)|GO:0045059(positive thymic T cell selection)|GO:0045214(sarcomere organization)|GO:0045597(positive regulation of cell differentiation)|GO:0045893(positive regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0045987(positive regulation of smooth muscle contraction)|GO:0046016(positive regulation of transcription by glucose)|GO:0046716(muscle cell homeostasis)|GO:0046983(protein dimerization activity)|GO:0048589(developmental growth)|GO:0048821(erythrocyte development)|GO:0051491(positive regulation of filopodium assembly)|GO:0055003(cardiac myofibril assembly)|GO:0060218(hemopoietic stem cell differentiation)

GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT

A_51_P100298

FALSE

NM_152220

20908

Stx3

syntaxin 3

Mm.272264

ENSMUST00000112965

ref|NM_152220|ens|ENSMUST00000112965|ens|ENSMUST00000069285|gb|AK170105

chr19:11859903-11857591

mm|19qA

Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA [NM_152220]

ATCGCCATGCTGGTGGAAAATCAGGGGGAGATGTTAGATAACATAGAGTTGAATGTCATG

A_51_P100309

FALSE

NM_001039652

18390

Oprm1

opioid receptor, mu 1

Mm.457998

ENSMUST00000092734

ref|NM_001039652|ens|ENSMUST00000092734|ens|ENSMUST00000056385|ens|ENSMUST00000150374

chr10:3516213-3516154

mm|10qA1

Mus musculus opioid receptor, mu 1 (Oprm1), mRNA [NM_001039652]

GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT

A_51_P100327

FALSE

NM_013683

21354

Tap1

transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)

Mm.482076

ENSMUST00000166582

ref|NM_013683|ref|NM_001161730|ens|ENSMUST00000166582|ens|ENSMUST00000041633

chr17:34330854-34330913

mm|17qB1

Mus musculus transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (Tap1), transcript variant 1, mRNA [NM_013683]

TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG

A_51_P100347

FALSE

NM_001033341

240476

Zfp407

zinc finger protein 407

Mm.329575

ENSMUST00000125763

ref|NM_001033341|gb|AK032536|ens|ENSMUST00000125763|tc|TC1605152

chr18:84731042-84730983

mm|18qE4

Mus musculus zinc finger protein 407 (Zfp407), mRNA [NM_001033341]

GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)

CAAATGAAACTCAGAGGATGTATATGAAACACTTTAGAACACAGATGAAAACAAACGCAC

A_51_P100379

FALSE

NM_177596

210853

Zfp947

zinc finger protein 947

Mm.441622

ENSMUST00000080249

ref|NM_177596|ens|ENSMUST00000080249|gb|AK032784|gb|BC120908

chr17:22281966-22281907

mm|17qA3.3

Mus musculus zinc finger protein 947 (Zfp947), mRNA [NM_177596]

GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)|GO:0046872(metal ion binding)

CCTGGTTATTTATATTCAGAAAAAAGTGTCCACTGGAAAACTATGGCATGTGCTTTATTC

A_51_P100428

FALSE

AK076663

Mm.444665

gb|AK076663|riken|4930408C10|nap|NAP088623-1

chr14:55610280-55610339

mm|14qC3

Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930408C10 product:myosin heavy chain, cardiac muscle, adult, full insert sequence. [AK076663]

AGGAAAATGAAGAAAGGCGATACATGGGCTTTTCCAAATGAGCTTATACATGAATGAAGA

Total number of rows: 41282

Table truncated, full table size 28135 Kbytes.

Download family	Format
SOFT formatted family file(s)	SOFT
MINiML formatted family file(s)	MINiML

Supplementary data files not provided