GEO Accession viewer

GSE7902	Novel cell lines from mouse epiblast share defining features with human embryonic stem cells
GSE8353	A Mathematical Model for Affymetrix GeneChip Probe Level Data
GSE8993	Normal human fibroblast cell line bystander effects by Carbon ion irradiation
GSE9067	Myeloma IRF4 target genes - Agilent
GSE9077	Expression profiles of immortal lung fibroblasts
GSE9187	Human breast cancer LM2 cell lines: control vs. MTDH knockdown
GSE9561	human induced pluripotent stem cell
GSE9869	Gene expression changes associated with the anti-angiogenic effect of KLK3 (PSA) on HUVECs
GSE10057	The Epstein-Barr Virus latent membrane protein 1 (LMP1) induces cellular microRNA146a
GSE10107	The EBV latent membrane protein 1 (LMP1) induces cellular microRNA-146a, a modulator of lymphocyte signaling pathways
GSE10164	PrEC response to Alanine or Sarcosine at 6 hours
GSE10455	Genes regulated by miR-34b/c and DAC
GSE10541	Polycomb CBX7 represses expression of tumor suppressor genes
GSE10570	Normal human prostate (NHP) epithelial cells: Senescent and immortalized cells compared to young progenitors
GSE10613	Convergence of Mutation and Epigenetic Alterations Identifies Common Target Genes in Breast and Colon Cancer
GSE10667	MMP1 and MMP7 as potential peripheral blood biomarkers in Idiopathic Pulmonary Fibrosis
GSE10863	microRNA-155 is an Epstein-Barr Virus induced gene that modulates EBV-regulated gene expression (EBV infection)
GSE10864	microRNA-155 is an Epstein-Barr Virus induced gene that modulates EBV-regulated gene expression (microRNA-155 infection)
GSE10868	microRNA-155 is an Epstein-Barr Virus induced gene that modulates Epstein Barr virus regulated gene expression pathways
GSE10956	Gene expression analysis in 13 patients with mitochondrial ATP synthase deficiency (Agilent)
GSE10959	siNTSR1-treated HNSCC cell lines: Control vs. siNTSR1-treated HSC2 or HSC3
GSE11132	22RV1 prostate cancer cell line transfected with SPINK1 siRNA vs control siRNA
GSE11173	Defining a Chromatin Pattern That Characterizes DNA Hypermethylated Genes in Colon Cancer Cells
GSE11205	Glycogen Synthase Kinase-3-beta Regulates Glucocorticoid Signaling by Phosphorylating the Glucocorticoid Receptor
GSE11233	The Cancer Genome Atlas (TCGA) Consortium Integrated DNA Methylation Analysis
GSE11242	2-Deoxyglucose induced transcription in control and MondoA knockdown cells
GSE11682	Gene expression profiles of reactive stroma in prostate cancer
GSE11946	Gene expression profiling of peripheral T-cell lymphoma including gamma delta T-cell lymphoma
GSE11968	Analysis of HeLa cells after transfection with miR-1, miR-124 and miR-181.
GSE11985	Gene expression analysis in renal cell carcinoma
GSE12075	The impact of microRNAs on protein output
GSE12114	Ror2 gene expression analysis in renal cell carcinoma
GSE12307	siRNA Administration Against AFP Inhibits Hepatocellular Carcinoma Proliferation in Vitro and Progression in Mice
GSE12384	Effect of IL6 level on gene expression changes in Peripheral Blood Mononuclear cells (PBMC) induced by physical activity
GSE12385	Gene expression changes in Peripheral Blood Mononuclear cells (PBMC) induced by physical activity
GSE12405	Gene expression of human primary macrophages induced by carbosilane dendrimer 2G-NN16 complexed with or without siRNA
GSE12553	Gene expression profiles following TP53 downregulation
GSE12928	NMD inhibition fails to identify tumour suppressor genes in microsatellite stable gastric cancer cell lines
GSE13216	Expression profile of PITX2 overexpressed HEK293 cells
GSE13286	miR101 overexpression vs. EZH2 RNAi
GSE13334	Effect of p53 in human iPS cell generation
GSE13365	Effect of p53 on iPS cell generation
GSE13407	Effect of T0901317, AM580 or T0901317+AM580 on monocyte gene expression
GSE13470	Glioblastoma microvesicles transport RNA and proteins
GSE13566	Direct contact with mesenchymal stromal cells impacts CD133+ hematopoietic stem cells during ex-vivo expansion
GSE13834	Transcriptional Profiling of Human Embryonic Stem Cell-Derived Cardiomyocytes
GSE13886	Response of p53 isogenic colorectal cancer panel to 12 Gy gamma irradiation
GSE13919	A Novel Androgen Receptor Splice Variant Is Upregulated during Prostate Cancer Progression
GSE14028	An Integrated Network of Androgen Receptor and TMPRSS2-ERG Gene Fusion in Prostate Cancer Progression (I)
GSE14048	Hypoxic shock in DLD-1 cells
GSE14097	An Integrated Network of Androgen Receptor and TMPRSS2-ERG Gene Fusion in Prostate Cancer Progression
GSE14261	Dexamethasone-resistant multiple myeloma cell line OPM1 treated with Dexamethasone and/or DAC
GSE14312	Microarray Analysis of Genes Regulated by Macrophage-Conditioned Media Treatment of Human Adipocytes
GSE14409	Ago2 associated gene transcripts in two Hodgkin lymphoma cell lines
GSE14476	Effect of tocopherol on caco-2 cells.
GSE14490	Transcriptome modulation analysis of cytomegalovirus-infected immature monocyte-derived dendritic cells
GSE14560	CLL: CD38+CD49d+ vs. CD38-CD49d-
GSE14617	CRY2 knockout in MCF7 cells
GSE14681	Long intronic non-coding RNA from the KLHL29 locus regulates proliferation of human tumorigenic cell lines
GSE14839	Differences in gene expression in islets isolated from pancreata donated after Cardiac Death relative to Brain Death
GSE14853	Circulating endothelial cells in patients with chronic lymphocytic leukemia: clinical and biological characterization
GSE14910	Transcriptional responses to nanoparticulate matter in human colon cancer cells.
GSE14972	GENE PROFILING AND PATHWAY ANALYSIS OF NASP EXPRESSION IN HELA CELLS
GSE14982	Reprogramming human fat cells into iPS cells
GSE15075	Gene expression profiling of monocyte-derived dendritic cells (DCs) from peripheral blood mononuclear cells (PBMCs)
GSE15076	Characterization of monocyte-derived dendritic cells (DCs) from peripheral blood mononuclear cells (PBMCs)
GSE15109	BG02 hESC Exposed to Butyrate
GSE15112	ESC Exposed to Butyrate
GSE15212	Identification and validation of NOL5A and RPS2 as potential therapeutic targtes in colorectal cancer
GSE15359	Gene Expression Profiling of Airway and Distal Lung Fibroblasts
GSE15549	Global analysis of differential polyadenylation of mRNAs in CPEB1 knockdown and CPEB4 knockdown at G2/M.
GSE15576	Effect of Genetic Variant in miR-196a-2 in MCF-7 cells
GSE15812	Gene expression changes in PBMCs from metabolic syndrome patients after acute intake of phenol-rich virgin olive oil
GSE15948	Down-regulation of SFRP1 in a mammary epithelial cell line
GSE16026	Effect of heteronemin on gene expression profiles in chronic myelogenous K562 leukemia cells
GSE16053	miR-17 seed family specific targets in two Hodgkin lymphoma cell lines
GSE16065	mutated IGHV3-23 CLL
GSE16113	Activation of Host Wound Responses in Breast Cancer Microenvironment
GSE16123	Multiomics study to identify virulence factors of Rickettsia prowazekii revealed its adaptive mutation capabilities
GSE16358	Scavenger receptor B2 is a cellular receptor for enterovirus 71
GSE16532	Endometrial gene expression analysis at the time of embryo implantation in women with unexplained infertility
GSE16641	Laughter specific genes and laughter sensitive genes
GSE16727	Human keratinocytes exposed to tungsten carbide and tungsten carbide cobalt nanoparticles and cobalt chloride
GSE16872	Molecular characterization of head and neck cancer cell model genomes
GSE16945	Comparative transcription profiling of peripheral blood mononuclear cells from vasculitis patients
GSE16957	Iodide effect on mRNA expression levels of genes related to immunological function in cultured human thyroid follicles
GSE17018	Detection of Treatment-Induced Changes in Signaling Pathways in GI Stromal Tumors using Transcriptomic Data
GSE17311	Runx1 (Aml1) knockdown in AMkL Meg-01 cells
GSE17403	Multiple platform assessment of the EGF dependent transcriptome by microarray and deep tag sequencing analysis
GSE17594	NOD2 and human ileal gene expression
GSE17623	The kinase TNIK is an essential activator of Wnt target genes
GSE17630	HER2-positive breast cancer cells resistant to trastuzumab and lapatinib lose reliance upon HER2 and are sensitive to the multitargeted kinase inhibitor sorafenib
GSE17632	BxPC-3 cells: growth in different nutrients
GSE17753	Impact of RNA degradation on gene expression profiling
GSE17766	CLOCK knockdown in MCF-7 cells
GSE17839	Human osteoblast treated with Melphalen
GSE17842	Human osteoblast treated with chemotherapy-treated bone marrow stromal cell conditioned media
GSE17843	Human osteoblast treated with recombinant TGF-beta
GSE17860	Expression profiles of human osteoblasts directly and indirectly damaged by chemotherapy
GSE17924	Genome-Wide Expression Profiling Deciphers Host Responses Altered during Dengue Shock Syndrome and Reveals the Role of Innate Immunity in Severe Dengue
GSE17992	Effects of dexamethasone on human skeletal muscle and adipose tissue
GSE18102	Control vs. HMEC-1 cells treated with 100ng/ml TNF-alpha for 4h and 24h
GSE18109	Propionibacterium acnes as a frequent inflammatory agent involved in prostate cancer
GSE18138	Identification of LATS transcriptional targets in HeLa cells using whole human genome oligonucleotide micorarray
GSE18316	Genopal: a novel platform for focused microarray analysis
GSE18390	Effects of retinoids on estrogen-receptor-positive and -negative breast carcinoma cells: mRNA profiling
GSE18438	Over-expression of hsa-miR-221 in JSC1 cells and identification of miRNA targets expressed in a panel of B-cell lines
GSE18439	Transcription repression of miR-221 leads to p27 expression in PEL
GSE18457	ChIP-chip from HCT116 cells treated with MMS and LNCaP cells with ATF3
GSE18612	Expression profiles of epicardial and subcutaneous adipose tissue
GSE18689	Genes regulated by high calcium medium in parathyroid tissue explants from patients with primary hyperparathyroidism
GSE18693	Effects of retinoids on estrogen-receptor-positive and -negative breast carcinoma cells: mRNA and miRNA profiling
GSE18817	Chronic Active B Cell Receptor Signaling in Diffuse Large B Cell Lymphoma
GSE18844	Expression consequences of decoy vs scrambled oligonucleotides harboring AAAA[AGT]TT motif in MBA-MD-231 cell line
GSE18849	ELK1 and NFYA knockdown in MBA-MD-231 cell line
GSE18874	Decoy vs Scrambled and siRNA vs Mock Transfected MBA-MD-231 Cell Line
GSE18875	Control of gene expression by the Retinoic acid-related Orphan Receptor alpha in HepG2 human hepatoma cells
GSE18966	Effect of exercise on gene expression profile in unfractionated peripheral blood leukocytes
GSE18971	Nutlin-3 treatment of B-CLL
GSE19324	Human primary subcutaneous preadipocytes: Control vs PBMC co-culture
GSE19362	Dissection of human fibroblast populations by lung regions: genomic differences and functional pathway analysis
GSE19494	Subcutaneous adipose tissue (SAT) gene expression patterns between weight control and regaining weight subjects
GSE19541	BRCA1 Haploinsufficiency Leads to Altered Expression of Genes Involved in Cellular Proliferation and Development
GSE19712	Identification of LY6K target genes in bladder cancer
GSE19716	Gene expression profiles of bladder cancer cell lines
GSE19717	Identification of miR-145 or miR-133a target genes in bladder cancer
GSE19718	Identification of miR-489 or miR-504 target genes in head and neck cancer
GSE19853	Gene expression profile of fresh human acute myeloid leukemia cells exposed ex vivo to AS602868
GSE19939	Effect of valproic acid on hematopoiesis: A functional profiling and cell phenotyping approach
GSE19992	Gene expression profiles of oxaliplatin resistant colorectal cancer and ovarian cancer cell lines
GSE20028	Identification of miR-145 or miR-133a target genes in squamous cell carcinoma
GSE20127	Direct generation of induced pluripotent stem cells from human non-mobilized blood
GSE20147	Profiling of cutaneous tumors
GSE20171	Bifidobacterium bifidum BF-1 Suppresses Helicobacter pylori-Induced genes in Human Epithelial Cells
GSE20298	A Gene Expression Signature for Chemoradiosensitivity of Colorectal Cancer Cells
GSE20506	Identification of cis- and trans-acting factors involved in the localization of MALAT-1 to nuclear speckles
GSE20680	Whole Blood Cell Gene Expression Profiling in Patients with Coronary Artery Disease from the Cathgen Registry
GSE20681	Whole Blood Cell Gene Expression Profiling in Patients with Coronary Artery Disease from the PREDICT Trial
GSE20686	Whole Blood Cell Gene Expression Profiling in Patients with Coronary Artery Disease (Homo sapiens)
GSE20690	Efficacy of anti-TNF biologic agent, infliximab, for RA patients using transcriptome analysis of white blood cells
GSE20750	Gene expression signatures for human iPS cell lines
GSE20842	Mutated KRAS induces overexpression of DUSP4, a MAP-kinase phosphatase, and SMYD3, a histone methyltransferase, in rectal carcinomas
GSE20906	Gene expression profiles of PNT1a prostate cells expressing FGFR-4 Arg388 or Gly388.
GSE20936	Transcriptomic analysis of normal and Ino-RNA treated cells.
GSE20937	Derivation of pre-X inactivation human embryonic stem cells under physiological oxygen concentrations
GSE20941	Mediators in Crohn’s disease influence the gene expression profiles of mesenchymal progenitor cells differentiated into the osteoblastic lineage.
GSE20945	Effects of DAC treatment
GSE20988	Cooperative Epigenetic Modulation by Cancer Amplicon Genes
GSE20993	Time-series toxicogenomics analysis of N-nitroso compound exposure in Caco-2 cells
GSE21201	CpG islands recruit a histone H3 lysine 36 demethylase [Agilent data]
GSE21202	CpG islands recruit a histone H3 lysine 36 demethylase
GSE21209	Gene expression changes upon knockdown or over-expression of the ETS gene ETV4 in prostate cancer cell lines
GSE21280	A critical role of microRNAs in human pulmonary arterial hypertension. miR-204: a novel therapeutic target (gene expression)
GSE21284	A critical role of microRNAs in human pulmonary arterial hypertension. miR-204: a novel therapeutic target
GSE21328	Transcriptome analysis of highly metastatic cell line
GSE21367	The Leukemia-associated Mllt10/Af10- Dot1l, dedicated b-catenin coactivators essential for intestinal homeostasis
GSE21501	A six-gene signature predicts survival of patients with localized pancreatic ductal adenocarcinoma
GSE21565	Microarray analysis of genes impacted by 5 day knockdown of SLC24A5 in normal human melanocytes.
GSE21586	Gene expression profile of classical Hodgkin lymphoma according to Epstein-Barr infection status
GSE21792	A murine-ES like state facilitates transgenesis and homologous recombination in human pluripotent stem cells
GSE21886	Identification of genes differentially expressed between control and SMILE siRNA transfected HeLa cells
GSE21959	Transcriptional response to hypoxia of normal and rheumatoid arthritis synovial fibroblasts
GSE22030	HO-1 modulates the expression of genes involved in inflammation, angiogenesis, proliferation, apoptosis and cell adhesion in human lung cancer cells.
GSE22032	Defining Cell Fate And Embryonic Genome Activation By Global Single-Cell cDNA Analysis of Blastomeres From 5-to 8-Cell Human Embryos.
GSE22085	The MALAT-1 noncoding RNA Regulates Cell Mobility by Modulating Gene Expressions
GSE22226	Heterogeneity of Response to Chemotherapy and Recurrence-free Survival in Neoadjuvant Breast Cancer: Results from the I-SPY 1 TRIAL
GSE22265	Identification of genes differentially expressed between control and EHF siRNA transfected HCT116 cells
GSE22323	Fungal allergen extracts-induced gene expression in airway epithelial cells (NCI-H292)
GSE22384	Systematic Bias in Genomic Classification Due to Contaminating Normal Tissue in Breast Tumor Samples
GSE22430	Inflammatory activation of airway epithelial cells by pyocyanin
GSE22586	The forced loss of Epstein Barr virus from Burkitt's lymphoma cells: uncomplemented cells vs BART miRNA complemented cells.
GSE22775	Musashi 2 regulates normal hematopoiesis and accelerates leukemogenesis (Leukemia cell lines)
GSE22778	Musashi 2 regulates normal hematopoiesis and accelerates leukemogenesis
GSE22866	DNA Methylation Profiling of Glioblastoma: Impact on Gene Expression and Clinical Outcome (Agilent Expression Study)
GSE22891	DNA Methylation Profiling of Glioblastoma: Impact on Gene Expression and Clinical Outcome
GSE22900	Highly Recurrent MYD88 Mutations That Promote Human Lymphoma Cell Survival
GSE22901	Determining IRF4 target genes using RNA interference in ABC-DLBCL and MM
GSE23019	Identification of differentially expressed miRNAs in BM+ vs. BM- lung cancer samples
GSE23074	Gene Expression Profiling of Tuberculous Meningitis
GSE23113	Transcriptome Signatures of Sezary Cells from Patients and Cultured Hut 78, Hut 102 and Jurkat Cells
GSE23131	Intrinsic differentiation potential of human postnatal MSC, Mab and MAPC reflected in their transcriptome
GSE23169	Transcriptional profiling of Ramos germinal center B cells
GSE23171	CRTC2 couples genotoxic stress and plasma cell differentiation in the germinal center
GSE23209	Molecular Signature of response and potential pathways related to resistance to the HSP90 inhibitor, 17-AAG, in breast cancer.
GSE23363	Human SV80 Cells: Control vs. Caspase-8 knock down
GSE23536	Human CEM Cells: Control vs. 2h or 4.5h Cluvenone Treated
GSE23669	Changes in polysome loading as a consequence of RHA downregulation [Agilent]
GSE23688	RNA immunoprecipitation to identify RHA-binding transcripts in HEK293 cells
GSE23689	Identification of RNA helicase A translation target mRNAs at the intersection of RNA precipitation and polysome arrays
GSE23773	Characterization of HT-29 cells cultured in NanoCulture plates
GSE23803	Bystander response to 2.5 Gy of protons in a human 3-dimensional skin model in 16 h after exposure
GSE23804	Bystander response to low dose (0.5 Gy) of alpha-particles in a human 3-dimensional skin model at 4h post-irradiation
GSE23807	Biological response to 2.5 Gy of X-rays in 3-dimensional skin model, Epi-200.
GSE23901	Biological response to low dose of alpha-particles in a human 3-dimensional skin model, in 1 and 16h after exposure to ionizing radiation.
GSE23903	Bystander responses to 0.5Gy of alpha-particles in a human 3-dimensional skin model in 4h after exposure to ionizing radiation
GSE23922	Transcription profiling of primed, ILT3-Fc treated CD8+ T suppressor cells vs. primed, untreated CD8+ counterparts
GSE23989	Global gene expression in Head and neck squamous carcinoma (KB) cells treated with the combination of 2-DG + 6-AN followed by irradiation (2-Gy)
GSE24020	NF-kB suppresses genomic instability in non-Hodgkin lymphomas
GSE24100	Isolation and characterization of cancer-associated fibroblast-like cells in the glioblastoma microenvironment
GSE24171	Prostate Cancer Field Effect
GSE24231	Gene expression analysis of Human CD34+ cells derived from bone marrow, mobilized peripheral blood, umbillial cord blood using Agilent Whole Human Genome Oligo Microarrays (one-color)
GSE24240	Viral and transgene-free human induced pluripotent stem (iPS) cells using non-integrating Sendai virus (SeV) vectors.
GSE24268	Gene expression profiling of human NK cells
GSE24370	Secreted Factors from Staphylococcus aureus Biofilm and Planktonic Cultures Differentially Impact Human Keratinocytes in vitro
GSE24432	Subcutaneous adipose tissue: comparison of weight maintainence and weight regain following an 8-week low calorie diet
GSE24731	Gene regulation by phosphomimetic Myc and retinoic acid
GSE24732	Gene Re-expression in Calu6 Tumors Following Epigenetic Therapy
GSE24782	Identification of target genes of tumor suppressor microRNAs in human cancer
GSE24876	Acute high dose X-irradiation-induced genomic changes in a lung tumor cell line
GSE24883	Worsening of Obesity and Metabolic Status Yields Similar Molecular Adaptations_Subcutaneous and Visceral Adipose Tissue
GSE24908	Human Papillomavirus 16 E5 modulates the expression of host microRNAs
GSE24951	Transcriptome of SATB1 transduced Hut78 cells
GSE25167	Transcriptional responses to nanoparticulate matter in human skin-derived cancer cells
GSE25193	Human fetal penile smooth muscle cells (hfPSCM): Control vs PCB mixtures treatments
GSE25200	Cyclosporine on fibroblast
GSE25289	Genome-Wide Expression Profiling of human tumor-infiltrating microglia/macrophages
GSE25346	Agilent expression analysis of LNCaP cells following 5'aza-treatment
GSE25453	Gene expression profiling of mesial temporal lobe epilepsy
GSE25623	Bone marrows infiltrating human neuroblastoma cells express high levels of calprotectin and HLA-G proteins.
GSE25624	The bone marrow microenvironment in patients with neuroblastoma: presence of IFN signature and significant down-regulation of CXCL12 expression
GSE25844	Early target genes of aflatoxin B1 in human hepatic cells
GSE25935	Genetic identification, replication, and functional fine-mapping of expression quantitative trait loci in primary human liver tissue [Agilent]
GSE25936	Interlaboratory study to determine the reproducibility of toxicogenomics datasets
GSE26088	Expression Profiling of Pancreatic Xenografts and Cell Lines
GSE26089	Expression Profiling and Array Comparative Genomic Hybridization of Pancreatic Xenografts and Cell Lines
GSE26106	Genetic identification, replication, and functional fine-mapping of expression quantitative trait loci in primary human liver tissue
GSE26129	Alterations in tumour necrosis factor signaling pathways associated with cytotoxicity and resistance to taxanes in tumour cells.
GSE26259	Gene expression profiles of MCF7 with CARM1 knocked down
GSE26321	Gene expression profiles of different subpopulations of hepatocellular carcinoma
GSE26322	Respiratory chain protein analysis and gene expression profiles of fibroblast cell lines from 9 patients with SURF1 gene mutations
GSE26411	Interactions with Fibroblasts are Distinct in Basal-like and Luminal Breast Cancers
GSE26692	Chlamydia trachomatis serogroup D disturbs epithelial tissue homeostasis in Fallopian tubes via paracrine Wnt signalling
GSE26721	MYBPH, a novel transcriptional target of NKX2-1/TTF-1, inhibits ROCK1 and actomyosin assembly, and reduces cell motility and tumor metastasis
GSE26812	Gene expression-based, individualized diagnostic GC/ABC prediction for relapse/refractory diffuse large B cell lymphoma (DLBCL)
GSE26855	Gene expression profile of H1 human embryonic stem cells, IMR90 lung fibroblasts, calcium induced keratinocytes, and primary hepatocytes
GSE26856	Gene expression profile of H1.5 knockdown and SIRT1 knockdown IMR90 cells versus control cells
GSE26857	Gene Regulation by the Human Glucocorticoid Receptor Dimerization Domain Mutant dim4
GSE26979	Human Linker Histone H1.5
GSE26993	Comparable mRNA expression of pluripotency-related genes in SNUhES3 cells cultured on autofeeder or xenofeeder system
GSE26996	Coordinated regulation of polycomb group complexes through microRNAs in cancer
GSE27173	GATA6 Activates Wnt Signaling in Pancreatic Cancer by Negatively Regulating the Wnt Antagonist Dickkopf-1
GSE27183	Comparative gene expression profiles induced by PPARγ and PPARα/γ agonists in human hepatocytes
GSE27254	Role of Aldoketoreductases and Other Doxorubicin Pharmacokinetic Genes in Doxorubicin Resistance, DNA binding, and Subcellular Localization
GSE27335	Genomic differences distinguish the myofibroblast phenotype of distal lung from airway fibroblasts
GSE27503	Microarray Analysis of Genes Regulated by Macrophage-Conditioned Media Treatment of Human Pre-Adipocytes
GSE27616	Agilent expression analysis of prostate cancer tissue samples
GSE27619	Deep sequencing reveals distinct patterns of DNA methylation and transcript isoform regulation in prostate cancer
GSE27842	Suppression of breast tumor growth and metastasis by an engineered transcription factor
GSE27900	Gene expression analysis of mesenchymal stem cells (MSC), osteoblasts and the U2OS (osteosarcoma) cell line
GSE27915	Transcription profiling of human olfactory ecto-mesenchymal stem cells (hOE-MSCs) from familial dysautonomia (FD) patients with or without kinetin treatment
GSE28000	Differential Gene Expression between African American and European American Colorectal Cancer Patients
GSE28038	Impact of Visceral Fat on Gene Expression Profile in Peripheral Blood Cells
GSE28045	Identification of novel target genes of nerve growth factor (NGF) in human mastocytoma cell line (HMC-1 (V560G c-Kit)) by transcriptome analysis
GSE28073	COMPARISON OF DORSOCERVICAL TO ABDOMINAL SUBCUTANEOUS ADIPOSE TISSUE IN PATIENTS WITH AND WITHOUT ANTIRETROVIRAL THERAPY-ASSOCIATED LIPODYSTROPHY
GSE28230	Comparison of gene expression profiles of A549 cell treated with NRF2 siRNA and control siRNA
GSE28253	Peripheral blood lymphocytes: ALS patients vs. healthy controls
GSE28300	Microarray-based identification of age-dependent differences in gene expression of human dermal fibroblasts
GSE28400	MIR-204 target genes
GSE28401	miRNA and Wilms' tumor
GSE28456	miR-142-3p over-expression in the Raji B-cell line
GSE28478	Hey3Met2 human ovarian cancer cells overexpressing wild type or catalytically-dead mutant RNASET2
GSE28501	The tumor suppressor gene rap1GAP is silenced by mir-101-mediated EZH2 overexpression in invasive squamous cell carcinoma
GSE28522	cDNA microarray analysis of miR-1 transfected HeLa and NPC-TW01 cells
GSE28615	Comparisson between tumour and healthy prostate glands
GSE28623	Pathway and functional association analysis of whole blood gene expression profiles reveal functional networks underlying TB pathogenesis. [Agilent-014850]
GSE28628	Identification of new genes involved in human adipogenesis and fat storage
GSE28650	Human Hair follicles: Control Vs. 0.5 µM spermidine treatment
GSE28658	Host response transcriptional profiling of typhoid fever infected Nigerian children
GSE28748	Human glioma cells: Control (GFP) vs PDGF-A expressing
GSE28813	Transcriptomic and proteomic profiling of KEAP1 disrupted and sulforaphane treated human breast epithelial cells
GSE28818	Comparison of gene expression pattern of THP-1 cell treated with ATRA and RAD001
GSE28877	Differentially expressed genes in metallopanstimulin-1 knockdown cells
GSE28907	Long-term in vitro expansion of epithelial organoids from human colon, adenoma, adenocarcinoma and Barrett's Esophagus
GSE28912	Role of Serine 134 phosphorylation of the glucocorticoid receptor (GR) in glucocorticoid signaling
GSE29000	ERG Overexpression in PC3 cells.
GSE29090	Comparison between Gene expression in stroma and glands of the transitional and peripheral zone of the prostate
GSE29141	Folic acid supplementation dysregulates gene expression in lymphoblastoid cells
GSE29270	Molecular Characterization of Breast Carcinoma Associate fibroblasts
GSE29288	Comparison between cell lines from 9 different cancer tissue (NCI-60) (Agilent WG platform)
GSE29405	Systems-wide RNAi analysis of CASP8AP2 / FLASH
GSE29507	Gene Expression Profiling of Tuberculous Meningitis coinfected with HIV
GSE29606	Gene expression profiles of effector T cells induced by mTOR inhibition
GSE29608	Gene expression profiles of effector T cells
GSE29746	Transcriptional analysis of normal and pathological synovial fibroblasts
GSE29760	Expression signature in a human colorectal cancer cell line HCT116 transfected with miR-1 precursor molecule
GSE29801	Systems-level analysis of age-related macular degeneration reveals global and subtype-specific functional pathways
GSE29861	Comparison of the MC-LR and MC-RR effects on Caco-2 cells
GSE29869	A human ESC model for MLL-AF4 reveals an impaired early human hemato-endothelial specification
GSE29886	LNCaP Prostate Cancer Cells: Control vs. siRNA-PCAT1 Treated
GSE29917	17beta-estradiol (E2)-regulated gene expression across time in estrogen-dependent and estrogen deprivation-resistant MCF-7-derived breast cancer cell lines.
GSE30023	A comparative gene expression profiling of spondyloarthropathy and rheumatoid arthritis using oligonucleotide based microarrays
GSE30105	CPG stimulation for Gene Expression of unmutated B-CLL
GSE30107	miRNA and mRNA expression profile of CLL cells
GSE30114	Microarray analysis of gene expression differences in prostate specific antigen negative (PSA-ve) cells versus PSA+ve cells in LAPC9 and LNCaP prostate cancer (PCa) cells
GSE30131	Expression profiles of X-ray responsive miRNA in human cells [mRNA data]
GSE30132	Expression profiles of X-ray responsive miRNA in human cells
GSE30171	B-cell chronic lymphocytic leukemia side population cells
GSE30181	COLO320 cells: siCDX2 vs. non-targeting control
GSE30432	Gene expression profiling of ElonginA knocked-down Hela cells in the presence of Doxorubicin
GSE30475	Colorectal Cancer Cells
GSE30592	A1-2 expression analysis of GR activation
GSE30664	Analysis of Gene expression of human Th17 and Th1 clones
GSE30904	RIP-Chip analysis of Musashi (Msi1) in the Daoy human medulloblastoma cell line.
GSE30961	FTC-238/hrTPO/RSK008 treated with thyroid peroxidase-disrupting chemicals
GSE30994	Prostate cancer specific gene expression
GSE31003	FOXA1 actively represses the molecular phenotype of basal breast cancers.
GSE31093	Knockdown and Overexpression of Cbx4 wild type and of a Cbx4 chromodomain mutant in human epidermal stem cells
GSE31095	Gene expression signature in platelets from healty vs. glioma patients
GSE31147	Knockdown and Overexpression of Cbx4 wild type, Cbx4 chromodomain mutant, and Cbx4 sumoylation mutant in human epidermal stem cells
GSE31195	Study of the consistency, comparability and identity of different Dendritic cells productions for clinical use
GSE31277	MicroRNA expression profile in Head and Neck Cancer: HOX-cluster embedded microRNA-196 and microRNA-10b dysregulation is implicated in cell proliferation
GSE31286	Whole genome analysis regulation in HepG2 cells exposed to cadmium
GSE31322	Activation of different signaling pathways in the regulation of biological properties of human pancreatic cancer cells by the mucin MUC4 and the oncogenic receptor ErbB2 genes
GSE31360	CPG stimulation for Gene Expression of mutated B-CLL
GSE31425	BT549 cells with control or NFIL3 shRNA treatment
GSE31426	HEK293 cells with control or NFIL3 shRNA treatment
GSE31427	Diminishment of NFIL3 by shRNA in HEK293 and BT549 cells
GSE31589	Expression of Epithelial-to-Mesenchymal Transition (EMT)-associated genes in extratumoral microenvironment predicts poor clinical outcome in breast cancer patients
GSE31728	Transcriptome sequencing across a prostate cancer cohort identifies PCAT-1, an unannotated lincRNA implicated in disease progression
GSE31802	Gene expression signatures in gastrointestinal stromal tumors (GISTs)
GSE31904	mRNA expression profiling in nine human tissues
GSE31965	Gene expression comparison between undifferentiated H9 cells and trophoblasts
GSE31981	Gene expression profiling of human vascular cells following gene transfer
GSE32026	Effetcs of several families of persistent organic pollutants on the undifferentiated and adipocyte differentiated human Multipotent Adipose-Derived Stem (hMADS) cells
GSE32143	LM2 cell: infected with lentivirus to stably express Elf5 vs GFP
GSE32144	MDA-MB-231 cell: infected with lentivirus to stably express mut-Elf5 vs WT-Elf5
GSE32150	Elf5 inhibits epithelial mesenchymal transition in development and cancer metastasis through transcriptional repression of Snail2
GSE32220	Cell-type independent MYC target genes reveal a primordial signature involved in biomass accumulation
GSE32221	Up-regulated aldo-ketoreductase1B10 in chronic hepatitis C: Association with serum alpha-fetoprotein and hepatocellular carcinoma
GSE32371	DNA methylation and gene expression changes during human embryonic stem cell differentiation
GSE32388	The unique role of GATA1s in Down syndrome acute megakaryocytic leukemia biology and therapy
GSE32413	Stable gene expression of serial skin biopsies defines patient subsets in diffuse cutaneous systemic sclerosis
GSE32441	TRAIL and taurolidine enhance the anticancer activity of doxorubicin, trabectedin and mafosfamide in human fibrosarcoma cells.
GSE32456	Co-addiction to IRF4 and SPIB in ABC-DLBCL
GSE32645	The unique molecular signature of cortical tissue injury in Multiple Sclerosis
GSE32709	DNA methylation regulates lineage-specifying genes in the human vascular system [expression array].
GSE32915	Oxidative damage and respiratory burst in Multiple Sclerosis
GSE33012	Exploiting Synthetic Lethality for the Therapy of ABC Diffuse Large B Cell Lymphoma
GSE33093	Meta-analysis of Clear Cell Renal Cell Carcinoma Gene Expression Defines a Variant Subgroup and Identifies Gender Influences on Tumor Biology
GSE33142	ICL002: Time course of Calu-3 cells infected with Influenza A/VN/1203/04
GSE33224	Protein coding gene expression profile of dasatinib-treated chronic myeloid leukemia patients with resistance to imatinib
GSE33264	TCL001: Calu-3 cells treated with either IFN alpha or gamma
GSE33267	SCL005: icSARS CoV Urbani or icSARS deltaORF6 infections of the 2B4 clonal derivative of Calu-3 cells - Time course
GSE33271	Expression of motor proteins in transgenic HeLa cell lines
GSE33272	Transcriptome analysis of primary human CD4+ T-cell activation
GSE33273	Transcriptome analysis of primary human monocyte differentiation
GSE33277	Castration-Resistant Prostate Cancer (CRPC)
GSE33290	Gene expression signatures of dasatinib-treated chronic myeloid leukemia patients with resistance to imatinib
GSE33526	Normal breast tissue of obese women is enriched for macrophage markers and macrophage-associated gene expression
GSE33615	Whole genome gene expression profiling in Adult T-cell Leukemia (ATL) cells and in Normal CD4+ T-cells
GSE33673	Epstein-Barr Virus (EBV)-positive B-cell strain, 28-2: Low v. High latent membrane protein 1 (LMP1)-mRFP expression
GSE33723	Molecular events in endometrial carcinosarcomas and the role of high mobility group AT-hook 2 in endometrial carcinogenesis.
GSE33731	Host cell tropism of Propionibacterium acnes: infection scenarios differ on skin and prostate epithelia
GSE33755	Effect of IL-1β on mesenchymal stem cells
GSE33812	Gene expression profiles of bone marrow mesenchymal stem cells in pediatric patients with severe aplastic anemia
GSE33824	Systems-wide RNAi analysis of different chr13 genes in colorectal cancer cell line (SW480)
GSE33910	Enhanced expression of Ficolin 1 is a specific gene marker of Takayasu's vasculitis
GSE34007	Hypoxia-induced modulation of gene expression in human adipocytes - A microarray study
GSE34077	Colon Cancer cell line YB5 untreated cells vs YB5 treated 24h with Depsipeptide at 20 nM
GSE34131	Gene expression profile of peripheral blood leukocytes of 60Co gamma-ray accidently-irradiated persons
GSE34153	Differential expression of metabolic genes in tumor and stromal components in primary and metastatic loci in pancreatic adenocarcinomas
GSE34228	Time-course gene expression profiles of gefitinib-sensitive or -resistant lung adenocarcinoma cells stimulated with EGF, in the presence or absence of gefitinib, EGF receptor tyrosine kinase-specific inhibitor
GSE34252	CD4+T cells activation
GSE34291	Gene expression profiling of Akt3 over-expressing breast cancer cells after estrogen and tamoxifen treatment
GSE34303	A Global Transcriptome Analysis of BMSC Senescence
GSE34396	Difference expression analyses before and after human fucosyltransferase gene 1 transfection into ovarian cancer clear cell line
GSE34429	Expression and DNA methylation of colon cancer cell lines
GSE34487	DNA methylation regulates lineage-specifying genes in the human vascular system.
GSE34499	Expression profile of maliganant mesothelioma cell lines
GSE34527	Female human induced pluripotent stem cells (hiPSCs)
GSE34792	Low Expression of SP1 has a Different Effect on Intestinal-type compared to Diffuse-type Gastric Adenocarcinoma
GSE34881	HNSCC Cells: ctrl vs six tumour lethal miRNAs transfected
GSE34940	HCT 116 cells expressing Fucci (fluorescent ubiquitination-based cell cycle indicator); G1 phase vs. S/G2/M phase
GSE35002	Human peripheral IL-10-secreting vs non- IL-10-secreting B cells
GSE35133	Development of gene expression signatures for mesenchymal stem cells from neuroblastoma patients
GSE35141	DCK is frequently inactivated in acquired gemcitabine-resistant human cancer cells.
GSE35142	Transcriptional responses to engineered nanoplatforms for drug delivery in primary human aortic endothelial cells.
GSE35163	Burkitt Lymphoma Pathogenesis and Therapeutic Targets from Structural and Functional Genomics
GSE35168	Transcriptional profiling of Lung H1299-BRG1 inducible cells
GSE35311	Integrative array-based approach identifies MZB1 as a frequently methylated putative tumor-suppressor in hepatocellular carcinoma (expression)
GSE35313	Integrative array-based approach identifies MZB1 as a frequently methylated putative tumor-suppressor in hepatocellular carcinoma
GSE35454	Gene expression analysis of U251 human glioblastoma cell line
GSE35477	CD98 marks a subpopulation of head and neck squamous cell carcinoma cells with stem cell properties
GSE35494	Control shRNA- vs. obscurin shRNA-expressing MCF10A cells
GSE35500	Gene expression and ChIP-chip analysis of U251 human glioblastoma cell line
GSE35576	Gene expression and ChIP-seq analyses of mesenchymal stem cells, osteoblasts and the U2OS osteosarcoma cell line
GSE35733	Microarray analysis of gene expression differences in prostate specific antigen negative (PSA-ve) cells versus PSA+ve cells in human prostate cancer (HPCa) samples
GSE35749	sRSM1 synthetic decoy vs. scrambled transfections in MDA-MB-231 cells
GSE35753	HNRPA2B1 RIP-chip
GSE35756	Whole-genome decay rate measurements in MDA-MB-231 cells transfected with HNRPA2B1 siRNAs versus controls
GSE35757	siRNA-mediated HNRPA2B1 knock-down in MDA-MB-231 cells
GSE35800	Systematic Discovery of Structural Elements Governing Mammalian mRNA Stability
GSE35814	The PSA-/lo prostate cancer cells harbor self-renewing long-term tumor-propagating cells that resist castration
GSE35982	Identifying microRNA-mRNA regulatory networks in colorectal cancer by a combination of expression profile and bioinformatics analysis
GSE35994	HepG2 Cell: Control vs. HGF treated
GSE36082	Small RNA-seq and gene expression analysis reveal a miRNA profile of cancer-susceptibility in ATM deficient human mammary epithelial cells (mRNA)
GSE36207	Translatome of Jurkat cells: control vs. stress treatment.
GSE36267	Small RNA-seq and gene expression analysis reveal a miRNA profile of cancer-susceptibility in ATM deficient human mammary epithelial cells
GSE36549	Expression correlates of the full-length androgen receptor and its splicing variants
GSE36654	Gene expression profile in HHUA treated with telmisartan
GSE36758	Expression profiling shows differential functions and provides potential new diagnostic biomarkers for colorectal serrated adenocarcinoma
GSE36854	Comparison of host cell gene expression in cowpox, monkeypox or vaccinia virus infected cells reveals virus-specific regulation of immune response genes
GSE36931	Rotating wall vessel (RWV) grown A549s compared to monolayer grown A549s
GSE37087	Examination of the role of peptidylarginine deiminase 2 (PAD2) in gene expression in MCF-7 breast cancer cells
GSE37110	Differentiating factors of cumulus cells related to quality of the human oocyte [CadoretPart1]
GSE37116	Differentiating factors of cumulus cells related to quality of the human oocyte [CadoretPart3]
GSE37117	Differentiating factors of cumulus cells related to quality of the human oocyte [CadoretPart2]
GSE37170	Gene expression profile in HHUA treated with scytonemin
GSE37257	EpCAM knock-down in FaDu head and neck carcinoma cells
GSE37277	Differentiating factors of cumulus cells related to quality of the human oocyte
GSE37326	HepG2 treated with Polycyclic Aromatic Hydrocarbons (PAHs)
GSE37575	Tumor-derived Tissue Factor Activates Coagulation and Enhances Thrombosis in a Mouse Xenograft Model of Human Pancreatic Cancer
GSE37738	Epidermolysis bullosa associated cutaneous SCC fibroblast expression profiling
GSE37785	Differential metabolic effects of insulin detemir versus NPH in patients with type 2 diabetes
GSE37888	PC-3 cells: siControl vs. siRNA ARHGAP21
GSE37957	Gene expression of the pigmented and non-pigmented epithelia of the ciliary body of human healthy eyes
GSE38227	Activation of TGF-beta pathway by areca nut constituents: A possible cause of Oral submucous fibrosis.
GSE38241	Gene expression profiling of normal prostates and prostate cancer metastases
GSE38242	DNA methylation alterations exhibit striking intra-individual stability and inter-individual heterogeneity across metastatic dissemination
GSE38330	Gene Expression Profiling of Human Pediatric Astrocytomas
GSE38544	Gene expression signatures in anti-FGFR2IIIc monoclonal antibody-treated human colorectal cancer cells
GSE38581	Gene expression signatures in miR-29c overexpressed gastric cancer cells.
GSE38959	Gene expression profiling of triple negative breast cancer, normal ductal cells, and normal tissues
GSE38974	Gene expression networks in COPD: microRNA and mRNA regulation
GSE39199	Gene Expression Response to Interferon Treatment at 12h and 24 in A549 cells
GSE39200	The NS1 protein of influenza A virus suppresses interferon-regulated activation of antigen-presentation and immune-proteasome pathways
GSE39202	NS1 protein of influenza A virus and interferon
GSE39400	Expression signature in peripheral blood cells for molecular diagnosis of head and neck squamous cell carcinoma
GSE39477	Prospective transcriptomic identification and validation of a circulating biomarker panel for human lymphatic vascular insufficiency
GSE39493	Gene expression profiling after S1004A induction
GSE39745	Human monocyte-derived dendritic cells treated with U0126 or SB203580
GSE39764	Gene profiles of pathway interference downstream neurofibromin signaling
GSE39768	Global analysis of genome, transcriptome and proteome reveals the response to aneuploidy in human cells
GSE39847	Gene Expression Profiling in T-ALL and B-ALL of Childhood Acute Lymphoblastic Leukemia
GSE40047	Genes Predictive of G1 arrest in Melanoma Cell Lines
GSE40185	Gene expression analysis of head and neck squamous cell carcinoma cell lines and a control normal oral epithelial cell line
GSE40206	Differential expression of genes and protein networks in the primary breast tumor that proceed to distant metastasis
GSE40315	Profiling of TGF-beta regulated genes in immortal and tumor cell-lines
GSE40383	Prostate cancer cell lines: non-targeting siRNA versus SChLAP1-siRNA treated
GSE40384	siRNA Knockdown of SWI/SNF complex proteins in prostate cancer cell lines
GSE40385	Overexpression of SChLAP1 versus LACZ in RWPE cells
GSE40386	SChLAP-1, a long non-coding RNA, antagonizes the SWI/SNF complex and coordinates aggressive prostate cancer.
GSE40682	Transcriptome profiling of breast cancer cells with Insulin like growth factor binding protein 2 (IGFBP2) knockdown
GSE40808	Rotating wall vessel (RWV) grown A549s compared to monolayer grown A549s infected with F. tularensis SchuS4 over a 22 hour time-course (2, 6 and 22 h post infection)
GSE41034	Essential role of MALT1 protease activity in activated B cell-like diffuse large B-cell lymphoma
GSE41110	VEGF-A stimulated gene expression in human liver sinusoidal endothelial cells
GSE41255	Screening for potential markers of metastases between low versus highly metastatic derived cell lines of same parental origin
GSE41436	High-throughput sequencing of small RNA transcriptomes and DNA microarrays reveal critical biological features targeted by microRNAs in cell models used for squamous cell cancer research
GSE41483	The role of nitric oxide synthase activity in connection with induced resistance against low-dose hyper-radiosensitivity
GSE41502	Nucleosome driven transcription factor binding and gene regulation [microarray]
GSE41617	Nucleosome driven transcription factor binding and gene regulati
GSE41651	Characterization of the EZH2-MMSET histone methyltransferase regulatory axis in cancer [expression]
GSE41653	Characterization of the EZH2-MMSET histone methyltransferase regulatory axis in cancer
GSE41744	Ficolin-1 is upregulated in leukocytes and glomeruli from microscopic polyangiitis patients
GSE41752	Transcriptional Profiling in Non-Human Primates Infected With Lassa Virus to Understand the Immune Response to Lassa Infection
GSE41781	Human dietary intervention study with blueberry-apple juice
GSE42099	Gene expression signatures for human iPSC and ESC lines
GSE42256	Identification of Novel Cholesteatoma-related Gene Expression Signatures Using Full-genome Microarrays
GSE42357	Gene expression compare between liver cancer associated mesenchymal stem cells (LC8-MSC) and liver normal mesenchymal stem cells (LN8-MSC)
GSE42401	Gene expression profiling of glioblastoma cell lines transfected with FGFR3-TACC3
GSE42402	The tumorigenic fusion FGFR3-TACC3 escapes miR-99a regulation in glioblastoma
GSE42520	Comparative analysis from hESC from different developmental sources of derivation
GSE42619	Gene expression profiles of MCF7 with with the following NR ligands: estradiol/E2 (ERα agonist), AM580 (RARA agonist), CD437 (RARG agonist), ATRA (RARA/RARG agonist), GW0742 (PPARD agonist), R5020 (PGR agonist), and dexamethasone (GR/NR3C1 agonist).
GSE42643	Direct reprogramming of human fibroblasts to functional hepatocyte-like cells
GSE42667	Effect of cigarette smoke on gene expression in mammary epithelial cells [gene expression]
GSE42668	Effect of cigarette smoke on gene expression in mammary epithelial cells
GSE42842	The predictive biomarkers of TNFα-blocking agent responsiveness are specific for adalimumab and etanercept
GSE42879	Overexpression of GATA1 confers resistance to chemotherapy in acute megakaryocytic leukemia
GSE42966	Transcriptional and interactome network analyses of Substantia Nigra in progressive stages of Parkinson’s disease
GSE43049	Caco-2 cells: cultured in conventional vs apical anaerobic conditions
GSE43219	mRNA changes induced by acute exercise
GSE43467	Role of HGF in epithelial-stromal cell interactions during progression from benign breast disease to ductal carcinoma in situ
GSE43611	Expression of M-CSF from cryopreserved teeth-derived human periodontal ligament cells with different freezing protocols
GSE43674	U87 cells implanted on a chick CAM (Chorioallantoic Membrane)
GSE43962	Upregulation of ERBB3 by FOXD3, an adaptive response to RAF and MEK inhibitors
GSE43973	Age-associated gene expression in normal breast tissue mirrors qualitative age-at-incidence patterns for breast cancer
GSE44066	Analyses of X-inactivation status in female human induced pluripotent stem cells
GSE44133	Tobacco-induced mRNAs profile alterations in human spermatozoa: a preliminary study for further knowledge of toxical spermatogenesis impairment
GSE44135	Tobacco-induced microRNAs and mRNAs profile alterations in human spermatozoa: a preliminary study for further knowledge of toxical spermatogenesis impairment
GSE44290	In Vitro Global Gene Expression Analyses Support the Ethnopharmacological Use of Achyranthes aspera
GSE44426	Transcriptome analysis of bone marrow mesenchymal stromal cells from patients with Primary Myelofibrosis
GSE44729	BEAS-2B cells: Control versus chemical exposure
GSE44941	Cancer-related epigenome changes among induced pluripotent stem cell lines
GSE44987	Microarray analysis of the leukocyte global gene expression profile following lithium treatment
GSE45158	Searching for human genes whose expression is controlled by nuclear paraspeckle
GSE45245	Gene expression regulation by miR-145 in pancreatic cancer
GSE45251	The inflammatory response of human airway smooth muscle cells
GSE45340	Combination of celecoxib and sorafenib provides synergistic antiproliferative and proapoptotic effects in human liver cancer cells
GSE45357	Gene expression profile of gliadin effects on intestinal epithelial cells suggests novel non-enzymatic functions of pepsin and trypsin
GSE45371	Absolute and induction TNF tolerance in primary human monocytes
GSE45403	Carbon-ion radiotherapy of human lung cancer
GSE45404	Integrative computational biology and molecular determinants of rectal cancer resistance to chemoradiotherapies
GSE45422	Effects of fluvastatin treatment on monocyte gene expression in SLE patients
GSE45531	Transcriptome profiling of T84 colorectal carcinoma cells treated with receptor guanylyl cyclace C agonist (stable toxin)
GSE45540	Gene signature of young, replicative and TNF-α-induced premature senescent of human microvascular endothelial cells-lung (HMVEC-L)
GSE45541	Young, replicative and TNF-a-induced premature senescent of human microvascular endothelial cells-lung (HMVEC-L)
GSE45596	Brain microvessel: Alzheimer disease vs normal
... Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here

Data table

COL

ROW

NAME

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

GENE

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

TIGR_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

SPOT_ID

ORDER

266

170

GE_BrightCorner

pos

266

168

DarkCorner

pos

266

166

DarkCorner

pos

266

164

DarkCorner

pos

266

162

DarkCorner

pos

266

160

DarkCorner

pos

266

158

DarkCorner

pos

266

156

DarkCorner

pos

266

154

DarkCorner

pos

266

152

DarkCorner

pos

266

150

DarkCorner

pos

266

148

A_24_P66027

FALSE

NM_004900

9582

APOBEC3B

apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B

Hs.226307

ENST00000407298

NP075413

ref|NM_004900|ref|NM_145699|ens|ENST00000407298|ens|ENST00000333467

chr22:37717484-37717543

hs|22q13.1

Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B), mRNA [NM_004900]

GCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCGCTGCAAATGCTGCGGGAT

266

146

A_32_P77178

FALSE

AA085955

Hs.12341

gb|AA085955|gb|AL567297|gb|BF871687|gb|BM671900

chr1:152822085-152822144

hs|1q21.3

AA085955 zl83f11.s1 Stratagene colon (#937204) Homo sapiens cDNA clone IMAGE:511245 3', mRNA sequence [AA085955]

GGTCAATTTTTGGTCAAAAGTACAGAGAGCATAGAATAAAAGCAAAGATGTGAATGTCTC

266

144

A_23_P212522

FALSE

NM_014616

23200

ATP11B

ATPase, class VI, type 11B

Hs.478429

ENST00000323116

THC2580543

ref|NM_014616|ens|ENST00000323116|gb|AB023173|gb|AL133061

chr3:184121316-184121375

hs|3q26.33

Homo sapiens ATPase, class VI, type 11B (ATP11B), mRNA [NM_014616]

GO:0000166(nucleotide binding)|GO:0000287(magnesium ion binding)|GO:0004012(phospholipid-translocating ATPase activity)|GO:0005524(ATP binding)|GO:0005637(nuclear inner membrane)|GO:0006754(ATP biosynthetic process)|GO:0006811(ion transport)|GO:0008152(metabolic process)|GO:0015075(ion transmembrane transporter activity)|GO:0015662(ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism)|GO:0015914(phospholipid transport)|GO:0015917(aminophospholipid transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016787(hydrolase activity)|GO:0016820(hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances)

ATTTTCTAACTGTCCTCTTTCTTGGGTCTAAAGCTCATAATACACAAAGGCTTCCAGACC

266

142

A_24_P934473

FALSE

AK092846

100132006

LOC100132006

hypothetical protein LOC100132006

Hs.593666

THC2483825

gb|AK092846|gb|AX747763|thc|THC2483825

chr16:8649039-8649098

hs|16p13.2

Homo sapiens cDNA FLJ35527 fis, clone SPLEN2001781. [AK092846]

AAGCCAAGTACTTTAGAGAAGAAAAACGGTCTCAGCTGAACCTGTAGTGAGAGCATGCAG

266

140

A_24_P9671

FALSE

NM_001539

3301

DNAJA1

DnaJ (Hsp40) homolog, subfamily A, member 1

Hs.445203

ENST00000330899

THC2482967

ref|NM_001539|gb|AY186741|ens|ENST00000330899|gb|BT007292

chr9:33026682-33027066

hs|9p13.3

Homo sapiens DnaJ (Hsp40) homolog, subfamily A, member 1 (DNAJA1), mRNA [NM_001539]

ATCCAGGTCAGATTGTCAAGCATGGAGATATCAAGTGTGTACTAAATGAAGGCATGCCAA

266

138

A_32_P29551

FALSE

THC2741789

thc|THC2741789

chr16:6029254-6029313

hs|16p13.3

CCTCTGTCTGGCTTTCTGGATCCTTAGATGAATTGCAGTTGGATTGGAATTTGGCACAAA

266

136

A_24_P801451

FALSE

NM_006709

10919

EHMT2

euchromatic histone-lysine N-methyltransferase 2

Hs.709218

ENST00000375537

THC2496448

ref|NM_006709|ref|NM_025256|gb|BC018718|ens|ENST00000375537

unmapped

Homo sapiens euchromatic histone-lysine N-methyltransferase 2 (EHMT2), transcript variant NG36/G9a, mRNA [NM_006709]

AAATCGGGCCATCCGCACCAGAGGAAGATCATTCTGCCGGGACGTGGCTCGGGGCTATGA

266

134

A_32_P30710

FALSE

NM_000978

9349

RPL23

ribosomal protein L23

Hs.406300

ENST00000245857

THC2496402

ref|NM_000978|gb|BC034378|ens|ENST00000245857|ens|ENST00000378096

chr17:34260229-34260170

hs|17q12

Homo sapiens ribosomal protein L23 (RPL23), mRNA [NM_000978]

ACGAAAGTCATACCGTAGAAAAGATGGCGTGTTTCTTTATTTTGAAGATAATGCAGGAGT

266

132

A_32_P89523

FALSE

T12590

Hs.568044

gb|T12590

chr9:129782208-129782267

hs|9q34.11

T12590 CHR90110 Chromosome 9 exon II Homo sapiens cDNA clone P94_55 5' and 3', mRNA sequence [T12590]

GAATTTCTTCTTCTTCATCAAGAAAGCCATGAGCGAGTTCCCTGAGTCTGAAGCCCCGAA