GEO Profile Links for Gene (Select 329918) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 299

<< First< Prev

Page of 15

Next >Last >>

Select item 1182928861.

Skint9 - Adam10 deficiency effect on the epidermis

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL6246, 10515134 (ID_REF), GDS5229, NM_177864, EF494907, chr4:112385969-112433985 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118292886

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1316395332.

Skint9 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P495747 (ID_REF), GDS5818, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131639533

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1090508863.

Skint9 - Phorbol ester effect on skin of Rho exchange factor Vav2/Vav3 double knockout mutants: time course

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL6246, 10515134 (ID_REF), GDS4985, NM_177864, EF494907, chr4:112385969-112433985 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 109050886

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 468183584.

Skint9 - Dicer inactivation effect on the embryonic heart

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL5025, 20858 (ID_REF), GDS3033, NM_177864

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46818358

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1092234285.

Skint9 - Diabetic db/db heart response to rosiglitazone

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL4134, 13528 (ID_REF), GDS4990, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109223428

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 130088126.

Skint9 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL891, 1612 (ID_REF), GDS1360, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13008812

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1304463337.

Skint9 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P495747 (ID_REF), GDS5666, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130446333

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 59509128.

Skint9 - High fat diet effect on aorta: time course

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL891, 1612 (ID_REF), GDS735, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5950912

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 75304929.

Skint9 - MPSS transcriptome analysis project

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTAGAAACTTGTGAAA (ID_REF), GDS868, NM_177864

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7530492

GEO DataSets Gene Chromosome neighbors

Select item 5537731210.

Skint9 - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL891, 1612 (ID_REF), GDS3386, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55377312

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12259144611.

Skint9 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2710079 (ID_REF), GDS5341, NM_177864

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122591446

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12786982312.

Skint9 - White adipose tissue development

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2979289 (ID_REF), GDS5528, NM_177864

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 127869823

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4416731213.

Skint9 - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL891, 1612 (ID_REF), GDS2924, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44167312

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11085738614.

Skint9 - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL6246, 10515134 (ID_REF), GDS5052, NM_177864, EF494907, chr4:112385969-112433985 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110857386

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11078398615.

Skint9 - Pristane-induced arthritis effect on AIRmax high acute inflammation model: footpad

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL6246, 10515134 (ID_REF), GDS5050, NM_177864, EF494907, chr4:112385969-112433985 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110783986

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 6256176216.

Skint9 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL6333, scl23983.7.1_16-S (ID_REF), GDS3621, NM_177864, A030013N09Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62561762

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 3190245417.

Skint9 - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL2872, 28054 (ID_REF), GDS2413, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31902454

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4141931718.

Skint9 - Nephronophthisis model

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL2897, 235109 (ID_REF), GDS2817, NM_177864

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41419317

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1879171719.

Skint9 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL2897, 235109 (ID_REF), GDS1729, NM_177864

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18791717

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1298551220.

Skint9 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Skint9, selection and upkeep of intraepithelial T cells 9

Organism:: Mus musculus

Reporter:: GPL891, 1612 (ID_REF), GDS1359, NM_177864, A_51_P495747 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12985512

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 329918) (299)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 299

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity