 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 30, 2012 |
| Title |
small RNAs (18-29nt) from MTD>piwi shRNA |
| Sample type |
SRA |
| |
|
| Source name |
Ovary
|
| Organism |
Drosophila melanogaster |
| Characteristics |
genotype: MTD>piwi shRNA
Stage: from 5-6 days old flies
tissue: ovary
|
| Growth protocol |
flies were grown at 25 degrees on standard medium
|
| Extracted molecule |
total RNA |
| Extraction protocol |
small-RNAs were cloned as described in Brennecke et al. 2007.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0)
fastq files were adapter 'AGATCGGAAGAGCACACGTCT' clipped using cutadapt, version 1.0, default settings
after adapter removal, the first and last 4 bases were trimmed (both linkers contain 4 random nucleotides at their respective termini) from sequence as well using HomerTools, version 3.9
Genome_build: dmel_release 5
Supplementary_files_format_and_content: combined table of sequences matching release 5 of the genome 100%; indicating sequence, genomic mapping number and read count for each library
|
| |
|
| Submission date |
Jun 14, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Julius Brennecke |
| E-mail(s) |
[email protected]
|
| Organization name |
IMBA
|
| Street address |
Dr. Bohrgasse 3
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE38728 |
Major concepts of piRNA biogenesis revealed by the analysis of Shutdown, a co-chaperone with essential roles in the biogenesis of all Drosophila piRNA populations |
|
| Relations |
| SRA |
SRX154646 |
| BioSample |
SAMN01048381 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
