|
| Status |
Public on May 27, 2015 |
| Title |
RNA-seq Imp KD replicate 3 |
| Sample type |
SRA |
| |
|
| Source name |
Schneider 2 (S2) cells
|
| Organism |
Drosophila melanogaster |
| Characteristics |
rt primer with random barcode / index: CAAGCAGAAGACGGCATACGAGATGCTACCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
|
| Growth protocol |
S2 cells were growth at 26C in Schneider's Drosophila Medium containing 10% heat inactivated fetal bovine serum, 100U/ml Penicillin and 100ug/ml Streptomycin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
5x106 cells were treated with 40µg/ml dsRNA corresponding to imp gene with boosts of dsRNA each day. On the third day the cells were harvested and total RNA was purified using TriReagent. 30ug of total RNA was enriched for mRNA using Poly(A)Purist MAG kit (Ambion) according to manufacturer’s specifications. Library was performed as described in (Kielpinski et al. 2013, Deep Sequencing Data Analysis). The 3' ligation adapter contains a 7'mer random barcode. 20 cycles of PCR was used to create the final library.
See individual experiment
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Cytoplamic mRNA
sample_vs_control_all_fcs_symbol.txt
|
| Data processing |
Base-calling was performed with CASAVA-1.8.2
Reads were demultiplexed using their fixed barcodes
Reads were trimmed at the 3'end to remove adapter sequences and low-quality sequences using custom python scripts. Reads shorter than 18nt were discarded.
Duplicated reads were collapsed using random barcodes to discriminate between identical sequences.
Reads were mapped to the Drosophila genome (dm3) + exon junction index (ensembl72) using BWA-PSSM with parameters -n 0.04 -l 1024-m 400 -P 0.99. PAR-iCLIP experiments were mapped modeling C>T conversions that arise due to the use of 4SU assuming a 12.5% conversion rate.
Confidently mapped reads with a posterior probability > 0.99 were further clustered according to their genomic positions.
Genome_build: dm3
Supplementary_files_format_and_content: Bedgraph files containing the read clusters
Supplementary_files_format_and_content: Plain text file containing the counts per gene, fold changes and p-values as calculated by DESeq
|
| |
|
| Submission date |
Nov 05, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Mireya Plass |
| E-mail(s) |
[email protected]
|
| Organization name |
MDC-Berlin
|
| Street address |
Robert-Rössle Str. 10
|
| City |
Copenhagen |
| ZIP/Postal code |
13092 |
| Country |
Germany |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE62997 |
Drosophila Imp iCLIP identifies an RNA assemblage co-ordinating F-actin formation |
|
| Relations |
| Reanalyzed by |
GSM3287523 |
| BioSample |
SAMN03164256 |
| SRA |
SRX751585 |
