GEO help: Mouse over screen elements for information.
Status
Public on Oct 07, 2011
Title
[miRNA-2] Affymetrix Multispecies miRNA-2 Array
Technology type
in situ oligonucleotide
Distribution
commercial
Organism
synthetic construct Manufacturer
Affymetrix
Manufacture protocol
See manufacturer's web site
Description
#%create_date=Wed Dec 22 13:03:44 PST 2010
Submission date
Sep 23, 2011
Last update date
May 02, 2017
Organization
Affymetrix, Inc.
E-mail(s)
[email protected] , [email protected] Phone
888-362-2447
URL
http://www.affymetrix.com/index.affx Street address
City
Santa Clara
State/province
CA
ZIP/Postal code
95051
Country
USA
Samples (3459)
GSM801091 , GSM801092 , GSM801093 , GSM801094 , GSM801095 , GSM801096
GSM836163 ,
GSM836164 ,
GSM836165 ,
GSM836166 ,
GSM836167 ,
GSM836168 ,
GSM836169 ,
GSM836170 ,
GSM836171 ,
GSM836172 ,
GSM836173 ,
GSM836174 ,
GSM836175 ,
GSM836176 ,
GSM836177 ,
GSM836178 ,
GSM836179 ,
GSM836180 ,
GSM836181 ,
GSM836182 ,
GSM836183 ,
GSM836184 ,
GSM836185 ,
GSM836186 ,
GSM848744 ,
GSM848745 ,
GSM848746 ,
GSM848747 ,
GSM848748 ,
GSM848749 ,
GSM848750 ,
GSM848751 ,
GSM848752 ,
GSM848753 ,
GSM848754 ,
GSM848755 ,
GSM848756 ,
GSM848757 ,
GSM848758 ,
GSM848759 ,
GSM848760 ,
GSM848761 ,
GSM870239 ,
GSM870240 ,
GSM870241 ,
GSM870242 ,
GSM870243 ,
GSM870244 ,
GSM870245 ,
GSM870246 ,
GSM885570 ,
GSM885571 ,
GSM885572 ,
GSM885573 ,
GSM885574 ,
GSM885575 ,
GSM885576 ,
GSM885577 ,
GSM885578 ,
GSM885579 ,
GSM885580 ,
GSM885581 ,
GSM885582 ,
GSM885583 ,
GSM885584 ,
GSM885585 ,
GSM885586 ,
GSM885587 ,
GSM885588 ,
GSM885589 ,
GSM885590 ,
GSM885591 ,
GSM885592 ,
GSM885593 ,
GSM926520 ,
GSM926521 ,
GSM926522 ,
GSM926523 ,
GSM926524 ,
GSM926525 ,
GSM926526 ,
GSM926527 ,
GSM926528 ,
GSM926529 ,
GSM926530 ,
GSM926531 ,
GSM926532 ,
GSM926533 ,
GSM926534 ,
GSM936813 ,
GSM936814 ,
GSM936815 ,
GSM936816 ,
GSM953936 ,
GSM953937 ,
GSM953938 ,
GSM953939 ,
GSM953940 ,
GSM953941 ,
GSM953942 ,
GSM953943 ,
GSM953944 ,
GSM953945 ,
GSM953946 ,
GSM953947 ,
GSM953948 ,
GSM953949 ,
GSM953950 ,
GSM953951 ,
GSM953952 ,
GSM953953 ,
GSM980300 ,
GSM980301 ,
GSM980302 ,
GSM980303 ,
GSM980304 ,
GSM980305 ,
GSM980306 ,
GSM980307 ,
GSM980308 ,
GSM980309 ,
GSM980310 ,
GSM980311 ,
GSM980312 ,
GSM980313 ,
GSM980314 ,
GSM980315 ,
GSM980316 ,
GSM980317 ,
GSM980318 ,
GSM980319 ,
GSM980320 ,
GSM980321 ,
GSM980322 ,
GSM980323 ,
GSM980324 ,
GSM980325 ,
GSM985105 ,
GSM985106 ,
GSM985107 ,
GSM985108 ,
GSM985109 ,
GSM985110 ,
GSM985111 ,
GSM985112 ,
GSM985113 ,
GSM985114 ,
GSM985115 ,
GSM985116 ,
GSM985117 ,
GSM985118 ,
GSM985119 ,
GSM985120 ,
GSM985121 ,
GSM985122 ,
GSM985123 ,
GSM985124 ,
GSM985125 ,
GSM985126 ,
GSM985127 ,
GSM985128 ,
GSM985129 ,
GSM985130 ,
GSM985131 ,
GSM985132 ,
GSM985133 ,
GSM1000469 ,
GSM1000470 ,
GSM1000471 ,
GSM1000472 ,
GSM1000473 ,
GSM1000474 ,
GSM1000475 ,
GSM1000476 ,
GSM1000477 ,
GSM1000478 ,
GSM1000479 ,
GSM1000480 ,
GSM1000481 ,
GSM1000482 ,
GSM1000483 ,
GSM1000484 ,
GSM1000485 ,
GSM1000486 ,
GSM1000487 ,
GSM1000488 ,
GSM1000489 ,
GSM1000490 ,
GSM1000491 ,
GSM1000492 ,
GSM1000493 ,
GSM1000494 ,
GSM1000495 ,
GSM1000496 ,
GSM1000497 ,
GSM1000498 ,
GSM1000499 ,
GSM1000500 ,
GSM1000501 ,
GSM1000502 ,
GSM1000503 ,
GSM1000504 ,
GSM1000505 ,
GSM1000506 ,
GSM1000507 ,
GSM1000508 ,
GSM1000509 ,
GSM1000510 ,
GSM1000511 ,
GSM1000512 ,
GSM1000513 ,
GSM1000514 ,
GSM1000515 ,
GSM1000516 ,
GSM1000517 ,
GSM1000518 ,
GSM1000519 ,
GSM1000520 ,
GSM1000521 ,
GSM1000522 ,
GSM1000523 ,
GSM1000524 ,
GSM1000525 ,
GSM1000526 ,
GSM1000527 ,
GSM1000528 ,
GSM1000529 ,
GSM1000530 ,
GSM1000531 ,
GSM1000532 ,
GSM1000533 ,
GSM1000534 ,
GSM1000535 ,
GSM1000536 ,
GSM1000537 ,
GSM1000538 ,
GSM1000539 ,
GSM1000540 ,
GSM1000541 ,
GSM1000542 ,
GSM1000543 ,
GSM1000544 ,
GSM1001136 ,
GSM1001137 ,
GSM1001138 ,
GSM1001139 ,
GSM1001140 ,
GSM1001141 ,
GSM1001142 ,
GSM1001143 ,
GSM1001144 ,
GSM1001145 ,
GSM1001146 ,
GSM1001147 ,
GSM1001148 ,
GSM1001149 ,
GSM1053326 ,
GSM1053327 ,
GSM1053328 ,
GSM1053329 ,
GSM1053330 ,
GSM1053331 ,
GSM1053332 ,
GSM1053333 ,
GSM1053334 ,
GSM1053335 ,
GSM1053336 ,
GSM1053337 ,
GSM1057962 ,
GSM1057963 ,
GSM1057964 ,
GSM1057965 ,
GSM1057966 ,
GSM1057967 ,
GSM1057968 ,
GSM1057969 ,
GSM1057970 ,
GSM1057971 ,
GSM1057972 ,
GSM1057973 ,
GSM1057974 ,
GSM1057975 ,
GSM1057976 ,
GSM1057977 ,
GSM1057978 ,
GSM1057979 ,
GSM1059188 ,
GSM1059189 ,
GSM1059190 ,
GSM1059191 ,
GSM1059192 ,
GSM1059193 ,
GSM1065985 ,
GSM1065986 ,
GSM1065987 ,
GSM1065988 ,
GSM1065989 ,
GSM1065990 ,
GSM1065991 ,
GSM1065992 ,
GSM1065993 ,
GSM1065994 ,
GSM1065995 ,
GSM1065996 ,
GSM1065997 ,
GSM1065998 ,
GSM1065999 ,
GSM1066000 ,
GSM1066001 ,
GSM1066002 ,
GSM1066003 ,
GSM1066004 ,
GSM1068061 ,
GSM1068062 ,
GSM1068063 ,
GSM1074087 ,
GSM1074088 ,
GSM1074089 ,
GSM1074090 ,
GSM1079584 ,
GSM1079585 ,
GSM1079586 ,
GSM1079587 ,
GSM1079588 ,
GSM1079589 ,
GSM1079590 ,
GSM1079591 ,
GSM1079592 ,
GSM1079593 ,
GSM1079594 ,
GSM1079595 ,
GSM1080125 ,
GSM1080126 ,
GSM1080127 ,
GSM1080128 ,
GSM1080129 ,
GSM1080130 ,
GSM1081746 ,
GSM1081747 ,
GSM1081748 ,
GSM1081749 ,
GSM1081750 ,
GSM1081751 ,
GSM1081752 ,
GSM1081753 ,
GSM1081754 ,
GSM1081755 ,
GSM1081756 ,
GSM1081757 ,
GSM1081758 ,
GSM1081759 ,
GSM1081760 ,
GSM1081761 ,
GSM1081762 ,
GSM1081763 ,
GSM1081764 ,
GSM1081765 ,
GSM1081766 ,
GSM1081767 ,
GSM1081768 ,
GSM1081769 ,
GSM1081770 ,
GSM1081771 ,
GSM1081772 ,
GSM1081773 ,
GSM1081774 ,
GSM1081775 ,
GSM1081776 ,
GSM1081777 ,
GSM1081778 ,
GSM1081779 ,
GSM1081780 ,
GSM1081781 ,
GSM1081782 ,
GSM1081783 ,
GSM1081784 ,
GSM1081785 ,
GSM1081786 ,
GSM1081787 ,
GSM1081788 ,
GSM1081789 ,
GSM1081790 ,
GSM1081791 ,
GSM1081792 ,
GSM1081793 ,
GSM1081794 ,
GSM1081795 ,
GSM1081796 ,
GSM1081797 ,
GSM1081798 ,
GSM1081799 ,
GSM1081800 ,
GSM1081801 ,
GSM1081802 ,
GSM1081803 ,
GSM1081804 ,
GSM1081805 ,
GSM1081806 ,
GSM1081807 ,
GSM1081808 ,
GSM1081809 ,
GSM1081810 ,
GSM1081811 ,
GSM1081812 ,
GSM1081813 ,
GSM1081814 ,
GSM1081815 ,
GSM1081816 ,
GSM1081817 ,
GSM1081818 ,
GSM1081819 ,
GSM1081820 ,
GSM1081821 ,
GSM1081822 ,
GSM1081823 ,
GSM1081824 ,
GSM1081825 ,
GSM1081826 ,
GSM1081827 ,
GSM1081828 ,
GSM1081829 ,
GSM1081830 ,
GSM1081831 ,
GSM1081832 ,
GSM1081833 ,
GSM1081834 ,
GSM1081835 ,
GSM1081836 ,
GSM1081837 ,
GSM1081838 ,
GSM1081839 ,
GSM1081840 ,
GSM1081841 ,
GSM1081842 ,
GSM1081843 ,
GSM1081844 ,
GSM1081845 ,
GSM1081846 ,
GSM1081847 ,
GSM1081848 ,
GSM1081849 ,
GSM1081850 ,
GSM1081851 ,
GSM1081852 ,
GSM1081853 ,
GSM1081854 ,
GSM1081855 ,
GSM1081856 ,
GSM1081857 ,
GSM1081858 ,
GSM1081859 ,
GSM1081860 ,
GSM1081861 ,
GSM1081862 ,
GSM1081863 ,
GSM1081864 ,
GSM1081865 ,
GSM1081866 ,
GSM1081867 ,
GSM1081868 ,
GSM1081869 ,
GSM1081870 ,
GSM1081871 ,
GSM1081872 ,
GSM1081873 ,
GSM1081874 ,
GSM1081875 ,
GSM1081876 ,
GSM1081877 ,
GSM1081878 ,
GSM1081879 ,
GSM1081880 ,
GSM1081881 ,
GSM1081882 ,
GSM1081883 ,
GSM1081884 ,
GSM1081885 ,
GSM1081886 ,
GSM1081887 ,
GSM1081888 ,
GSM1081889 ,
GSM1081890 ,
GSM1081891 ,
GSM1081892 ,
GSM1081893 ,
GSM1081894 ,
GSM1081895 ,
GSM1081896 ,
GSM1081897 ,
GSM1081898 ,
GSM1081899 ,
GSM1081900 ,
GSM1081901 ,
GSM1081902 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (187)
GSE32352 Role of microRNAs in Neural Stem Cell-supported Endothelial Morphogenesis
GSE33809 Inhibition of Jak2 in SET2 cell line with INC424 (two time points and 3 dose levels in triplicate)
GSE34413 Persistent Alterations in the imprinted miRNA and snoRNA populations in mouse models of fetal alcohol spectrum disorders (FASD)
GSE35532 MicroRNA expression in lineage specific hematopoiesis
GSE36257 Expression analysis in multiple muscle groups and serum reveals complexity in the microRNA transcriptome of the mdx mouse and implications for therapy
GSE37734 miRNA expression data from human cell lines (Panc1 cells)
GSE38213 Identification and comparative analysis of microRNAs associated with low-N tolerance in rice genotypes
GSE39015 Stability of miRNA in FFPE tumour samples exhibiting degraded mRNA [Cervix samples miRNA]
GSE39067 Stability of miRNA in FFPE tumour samples exhibiting degraded mRNA
GSE39845 Tissue and blood microRNA array profiles of colorectal cancer patients
GSE40113 Distinct Micro-RNA profiles are associated with severity of hepatitis C virus recurrence and acute cellular rejection after liver transplant
GSE40744 Identification of microRNAs specifically expressed in HCV-associated hepatocellular carcinoma
GSE40772 Differences in miRNA Detection Levels are Technology and Sequence Dependent [Affymetrix array]
GSE40820 Differences in miRNA Detection Levels are Technology and Sequence Dependent
GSE42915 Differential miRNA expression profiles in the first and third trimester human placentas
GSE43178 MicroRNA regulate immunological pathways in T-cells in immune thrombocytopenia (ITP) [miRNA]
GSE43179 MicroRNA regulate immunological pathways in T-cells in immune thrombocytopenia (ITP)
GSE43249 Noncoding RNA expression profiling of cisplatin-resistant cells derived from the A549 lung cell line (miRNA)
GSE43494 Noncoding RNA expression profiling of cisplatin-resistant cells derived from the A549 lung cell line
GSE43590 MicroRNA regulate immune pathways in T-cells in multiple sclerosis (MS) miRNA
GSE43592 MicroRNA regulate immune pathways in T-cells in multiple sclerosis (MS)
GSE43676 microRNA signature is altered in both human epididymis and seminal microvesicles following vasectomy.
GSE43890 MiRNA expression profiling in bone-marrow-derived neutrophils of lcn2 deficient mouse
GSE43891 Expression profiling in bone-marrow-derived neutrophils of lcn2 deficient mouse
GSE44139 miRNAs were significantly regulated by myocardin and ERα
GSE44179 Role of micro-RNAs in pathophysiology of diabetic cardiomyopathy.
GSE44281 Serum microRNA expression as an early marker for breast cancer risk in prospectively collected samples from the Sister Study cohort
GSE45604 Identification of miRNAs specific for prostate cancer (PCa)
GSE45816 miRNA profiling in HEV71-infected SH-SY5Y cells
GSE46282 Expression data of multiple sclerosis patients receiving Interferon-beta therapy [miRNA-2_0]
GSE46293 Expression data of multiple sclerosis patients receiving Interferon-beta therapy
GSE46823 miRNA expression profiles of primary ER-positive breast tumors following Tamoxifen treatment
GSE46891 Copper-induced deregulation of microRNA expression in the zebrafish olfactory system
GSE47131 Hormonal Regulation of MicroRNA Expression in Rat Adrenal Gland
GSE47439 Lymph node CD4+ T cell miRNA expression data from naïve C57BL/6J and C57BL/6J-ChrY^SJL
GSE47440 The Y chromosome as a regulatory element shaping immune cell transcriptomes and susceptibility to autoimmune disease
GSE47841 Expression data from high-grade serous ovarian carcinomas (HGSC), clear cell ovarian carcinomas (CCC) and ovarian surface epithelium (OSE)
GSE48088 Expression of miRNAs in breast tumor from very youn women (<36) and women above 65 years old
GSE48270 Molecular Characterization of Heat Intolerance in Mice (microRNA data)
GSE48271 Molecular Characterization of Heat Intolerance in Mice: microRNA (Affymetrix) and mRNA (Illumina) platforms
GSE48412 miRNA expression data from skeletal muscle stem cells
GSE48469 microRNA (miRNA) expression data from induced pluripotent stem cell derived (iPSC) derived cardiomyocytes exposed to soman/GD
GSE48470 microRNA (miRNA) expression data from induced pluripotent stem cell derived (iPSC) derived cardiomyocytes exposed to VX
GSE48669 microRNA (miRNA) expression data from induced pluripotent stem cell (iPSC)-derived neurons exposed to soman/GD
GSE48670 microRNA (miRNA) expression data from induced pluripotent stem cell (iPSC)-derived neurons exposed to VX
GSE48957 Mucosal miRNA expression profiling in (un)inflamed colon of patients with ulcerative colitis (UC)
GSE48959 Mucosal expression profiling in (un)inflamed colon of patients with ulcerative colitis (UC)
GSE49330 Integrated expression profiles of mRNA and miRNA in polarized primary murine microglia (miRNA)
GSE49331 Integrated expression profiles of mRNA and miRNA in polarized primary murine microglia
GSE49884 microRNA expression profile in HEK293T cells infected with Chikungunya virus
GSE50087 Effects of YB-1 protein reduction on microRNA abundance in breast cancer cell-lines
GSE50141 Identification of miRNAs which bind to YB-1 protein
GSE50142 Links between the Oncoprotein YB-1 and Small Non-Coding RNAs in Breast Cancer
GSE50216 miRNA expression profiling in neural differentiated mouse embryonic stem cells (mESCs) under exposure to sodium valproate and sodium arsenite
GSE50217 Neural differentiated mouse embryonic stem cells (mESCs) under exposure to sodium valproate and sodium arsenite
GSE50839 Expression data from activated NK cells [miRNA]
GSE50840 Expression data from activated NK cells
GSE51306 Helicobacter pylori-induced changes in miRNA expression in human gastric epithelial cells
GSE51554 MicroRNA expression of clear cell papillary renal cell carcinoma
GSE51658 miRNA expression data from post-partum dairy cattle (Holstein Friesian) liver
GSE51946 miRNA profile of lung adenocarcinoma cells treatment with monoclonal antibody NJ001 [miRNA_12h_24h_48h]
GSE51947 miRNA profile of lung adenocarcinoma cells treatment with monoclonal antibody NJ001
GSE52377 Differential expression of mature miRNAs in P19 cells during neuronal differentiation and by Rbfox3 depletion.
GSE52584 Gene and microRNA transcriptome analysis of Parkinson's related LRRK2 mouse models
GSE53476 miRNA expression profiles in YT and NK92 cells
GSE53482 Integrative Analysis of Gene and miRNA expression profiles in Primary Myelofibrosis CD34+ cells
GSE53519 Persistence of Smoking-induced Dysregulation of Small Airway Epithelium miRNA Expression Despite Smoking Cessation
GSE53859 MicroRNA expression profiles in WT and APP/PS1 mouse hippocampus
GSE54537 MicroRNA Profiling of Laser-Microdissected Hepatocellular Carcinoma Reveals an Oncogenic Phenotype of the Tumor Capsule
GSE55138 Expression data from ccRCC specimens
GSE55245 micro RNA-379 couples glucocorticoid hormones to metabolic dysfunction in diabesity
GSE55299 miRNA expression in aging skin
GSE55507 miRNA expression in fast and slow skeletal muscle of wild type and SOD1-G93A mice
GSE55720 Effect of lymphotoxin beta receptor blockade on microRNA expression in the spleen [AffyMircoRNA]
GSE55722 Effect of lymphotoxin beta receptor blockade on microRNA expression in the spleen
GSE55856 Comprehensive Analysis of Recurrence-Associated Small Non-Coding RNAs in Esophageal Cancer [Affymetrix]
GSE55857 Comprehensive Analysis of Recurrence-Associated Small Non-Coding RNAs in Esophageal Cancer
GSE56183 Integrated miRNA-mRNA analysis revealing the potential roles of miRNAs in chordomas
GSE57050 miRNA Profile in Normal and Preeclamptic Placenta
GSE57372 miRNA profiling of EV71 infected HT29 cells
GSE58248 Multi-Omic Integrated networks connect DNA methylation and miRNA with skeletal muscle plasticity to chronic exercise in type 2 diabetic obesity [miRNA data]
GSE58250 Multi-Omic Integrated networks connect DNA methylation and miRNA with skeletal muscle plasticity to chronic exercise in type 2 diabetic obesity
GSE60060 miRNA expression profiles from neurogenic differentiation of mesenchymal stem cells under conditioned microenvironments
GSE60628 miR-155-5p regulates immune cell recruitment to the fetal lung after choriodecidual Group B Streptococcal infection
GSE60688 Phenobarbital Induces Cell Cycle Transcriptional Responses in Mouse Liver Humanized for Constitutive Androstane and Pregnane X Receptors (miRNA)
GSE60693 Phenobarbital Induces Cell Cycle Transcriptional Responses in Mouse Liver Humanized for Constitutive Androstane and Pregnane X Receptors
GSE60819 Effects of acute prenatal exposure to ethanol on microRNA expression are ameliorated by environmental manipulation.
GSE60901 Comparison of small RNA-seq and microarray analysis for determining the effects of acute prenatal ethanol exposure on microRNA expression and its amelioration by environmental manipulation
GSE62030 Integrated ordination of miRNA and mRNA expression profiles [miRNA]
GSE62037 Integrated ordination of miRNA and mRNA expression profiles
GSE62346 Neonatal morphine exposure alters mRNA and microRNA (miR) expression in mouse hippocampus
GSE62386 In vivo activation of a conserved microRNA program induces robust mammalian heart regeneration (array)
GSE62389 In vivo activation of a conserved microRNA program induces robust mammalian heart regeneration
GSE62589 Integrative Analysis of Transcriptomic and Epigenomic Data to Reveal Regulation Patterns for Osteoporosis Risk
GSE63446 Integrative Analysis of Transcriptomic and Epigenomic Data to Reveal Regulation Patterns for Osteoporosis Risk [miRNA]
GSE63954 Collaborative Cross founder strain lung miRNA expression after allergen challenge
GSE64281 Expression data for human nasopharyngeal carcinoma cell line HK1 stimulated with EGF or TGF-β recombinant protein.
GSE65047 Sperm miRNA expression data from male C57BL/6J, C57BL/6J-ChrY^SJL, and C57BL/6J-ChrY^RF
GSE65048 Copy number variation in Y chromosome multicopy genes is linked to a paternal parent-of-origin effect on CNS autoimmune disease in female offspring
GSE66075 Emergence of a developmental stage-dependent human liver disease signature demonstrated by directed differentiation of alpha-1 antitrypsin deficient iPS cells [miRNA-2_0]
GSE66078 Emergence of a developmental stage-dependent human liver disease signature demonstrated by directed differentiation of alpha-1 antitrypsin deficient iPS cells
GSE66645 Expression data from ethanol and saline exposed mice [miRNA]
GSE66646 Expression data from ethanol and saline exposed mice
GSE67375 Neuropathic Gaucher mouse brain
GSE67496 ADAR1 regulates the resistance of melanoma cells to T cells via miR-222 and ICAM1
GSE67689 The microRNA expression profile in donation after cardiac death (DCD) livers and its ability to identify primary non function
GSE67814 miR-182 modulates myocardial hypertrophic response induced by angiogenesis in heart (miRNA)
GSE67824 miR-182 modulates myocardial hypertrophic response induced by angiogenesis in heart
GSE68233 Differentially expressed miRNAs in H2AX knockdown cells undergoing apoptosis
GSE68285 miRNAs expression profile of the cumulus cell samples with PCOS and non-PCOS
GSE68387 IMI MARCAR Project: towards novel biomarkers for cancer risk assessment
GSE68502 Expression data from HEK 293T cells overexpressing either myc-FUS or myc-R495X (miRNA)
GSE68504 Expression data from HEK 293T cells overexpressing either myc-FUS or myc-R495X
GSE69882 MicroRNAs of the RPE are essential for RPE differentiation and photoreceptor maturation (microRNA)
GSE69883 MicroRNAs of the RPE are essential for RPE differentiation and photoreceptor maturation
GSE70754 The prognostic significance of the dynamic changes of miRNA expression in locally advanced BC during neo-adjuvant chemotherapy treatment
GSE71579 Alterations in serum microRNA in humans with alcohol use disorders impact cell proliferation and cell death pathways and predict structural and functional changes in brain
GSE71652 Alterations in serum microRNA in humans with alcohol use disorders impact cell proliferation and cell death pathways and predict structural and functional changes in brain [mouse NSC miRNA 2.0]
GSE71653 Alterations in serum microRNA in humans with alcohol use disorders impact cell proliferation and cell death pathways and predict structural and functional changes in brain [rat miRNA 2.0]
GSE72527 Intercellular transfer of small RNAs from astrocytes to lung tumor cells induces resistance to chemotherapy.
GSE73171 MicroRNA deregulation in laryngeal squamous cell carcinoma cell lines
GSE73689 Screening and validation of lncRNAs and circRNAs as miRNA sponges [siRNA, miRNA-2_0]
GSE73690 Screening and validation of lncRNAs and circRNAs as miRNA sponges [cell lines, miRNA-2_0]
GSE73691 Screening and validation of lncRNAs and circRNAs as miRNA sponges
GSE74562 In vitro microRNA screening in human pancreatic adenocarcinoma
GSE74574 microRNA screening in human pancreatic adenocarcinoma
GSE74618 Re-expression of fetal IGF2 as a target for hepatocellular carcinoma therapy
GSE77152 Chorioamnion after choriodecidual Group B Streptococcal infection
GSE78742 Expression data from Nasopharyngeal carcinoma cell SUNE1
GSE79326 miRNA expression profiles of estrogen-dependent and estrogen deprivation-resistant MCF-7 breast cancer cell lines
GSE79350 Title: Aging-associated changes in microRNA expression profile of internal anal sphincter smooth muscle: Role of microRNA-133a
GSE79455 Genome-wide microRNA expression profiling in tunicamycin treated NIH3T3 cells
GSE80756 Effect of NIK overexpression on Foxp3+CD4+ and Foxp3-CD4+ T cell subsets [Affymetrix]
GSE80757 Effect of NIK overexpression on Foxp3+CD4+ and Foxp3-CD4+ T cell subsets
GSE81821 MicroRNAs related with the metastasis of human tongue squamous cell carcinoma
GSE81930 SNAI1 overexpression effect on MCF-10A mammary epithelial cell line (miRNA)
GSE81931 SNAI1 overexpression effect on MCF-10A mammary epithelial cell line
GSE82095 MicroRNA expression data from bone marrow T cells of acquired aplastic anemia patients and healthy individuals
GSE83994 miRNA expression profiling divides follicular dendritic cell sarcomas into two groups, related to fibroblasts and myopericytomas or Castleman's disease
GSE84303 Expressing profiles of small non-coding RNA in mouse models of oxygen-induced retinopathy (OIR)
GSE84434 MicroRNA Expression data from transgenic mice
GSE84435 Total and MicroRNA from transgenic mice
GSE84960 Smooth muscle cell mineralocorticoid receptor regulation of vascular microRNAs with aging
GSE85105 miRNA Biomarker candidates fo the detection of endometrial atypical hyperplasia
GSE86195 MiRNA Expression Profiling in Cisplatin Resistance Human Gastric Cancer Cell Lines and Their Parental Cell Lines
GSE86277 A microRNA signature identifies four subtypes of triple-negative breast cancer I
GSE86948 A microRNA signature identifies four subtypes of triple-negative breast cancer and correlates miR-342-3p as a regulator of the lactate metabolic pathway through silencing the monocarboxylate transporter 1
GSE87488 miRNA expression data from mice Ago2-amygdala
GSE87490 Amygdalar microRNA-15a is essential for coping with chronic stress
GSE90146 miRNA expression data in Huh-7 cell line transfected with HBeAg-expression vector
GSE90147 Expression data in Huh-7 cell line transfected with HBeAg-expression vector
GSE90972 microRNA expression data from a heterozygous Titin-deficient mouse model and wildtype controls
GSE93169 miRNA expression from gp130F/F mice antrum at 4 weeks of age
GSE93196 Identification of a signal transducer and activator of transcription 3-regulated microRNA-200 family signature with prognostic potential in early gastric cancer
GSE93212 809094 Biomarker Identification in Fracture Healing (experiment #3873 miRNA performed Apr 2011)
GSE93390 809094 Biomarker Identification in Fracture Healing (experiment #4068 performed)
GSE96953 microRNA expression profile of NPTr cells infected with swine H1N1/2009 influenza A virus
GSE101563 miRNA expression of Tubulocystic Renal Cell Carcinoma (TC-RCC) cases
GSE102127 Mucosal miRNA expression profiling in ileum of patients with Crohn's disease
GSE102134 Mucosal miRNA and gene expression profiling in ileum of patients with Crohn's disease
GSE102883 Expression data of miRNA from parental B16F0 cells and B16F0 exosomes [miRNA]
GSE102951 Expression data from parental B16F0 cells and B16F0 exosomes
GSE103176 Gene and miRNA expression profiles in Polycythemia Vera and Essential Thrombocythemia according to CALR and JAK2 mutations
GSE103238 Gene and miRNA expression profiles in Polycythemia Vera and Essential Thrombocythemia according to CALR and JAK2 mutations [miEP]
GSE103640 microRNA expression data from mouse primary stomach tissues
GSE103641 Gene and microRNA expression data from mouse primary stomach tissues
GSE104554 Expression data from glioblastoma tissue
GSE106501 The effect of estrogen on microRNA expression in primary cultured rat neonatal cardiomyocytes
GSE109736 A novel systems immunology approach identifies the collective impact of five miRNAs in Th2 inflammation (microRNA)
GSE109737 A novel systems immunology approach identifies the collective impact of five miRNAs in Th2 inflammation
GSE110402 miRNA profiles in invasive front of pT1 colorectal cancer
GSE116148 MicroRNA array analysis from infected and uninfected PBMC samples
GSE116182 MicroRNA expression profile in human hepatocellular carcinoma
GSE121396 miRNA expression in breast cancer cell lines
GSE136020 The miRNA Profile and Bioinformatic Analysis for Diagnosis in Patients with Stage IIIA Colon Cancer
GSE140776 Expression data (microRNA) from developing Neural Tubes of mouse embryos
GSE140777 Integrated Expression Profiling of MicroRNAs and Messenger RNAs in the Developing Neural Tube
GSE146477 Microarray analysis of miRNA in breast cancer cell lines
GSE166961 Detection of microRNAs in the plasma of cardiac surgery patients of high and low risk of developing non occlusive mesenteric ischemia
GSE167630 Circulating non-coding RNAs in Huntington disease
GSE183224 Global miRNA Expression of Bone Marrow Mesenchymal Stem/Stromal Cells in Fanconi Anemia Patients Before Transplantation and their Allogeneic Bone Marrow Donors
GSE183225 Global miRNA Expression of Bone Marrow Mesenchymal Stem/Stromal Cells in Fanconi Anemia Patients Before and After Bone Marrow Transplantation, and their Allogeneic Bone Marrow Donors
GSE183226 Global miRNA Expression of Bone Marrow Mesenchymal Stem/Stromal Cells in Fanconi Anemia Patients Before Transplantation and Unpaired Bone Marrow Donors
GSE183227 Global miRNA Expression of Bone Marrow Mesenchymal Stem/Stromal Cells in Fanconi Anemia Patients
GSE186666 Expression data of microRNAs from human lung cancer at different clinical types
GSE196616 MicroRNA expression data from LCMV infected CD8 T cells
GSE217222 miRNA expression from mouse adipose tissues
Data table header descriptions ID Species Scientific Name Annotation Date Sequence Type Sequence Source Transcript ID(Array Design) Alignments Sequence Length Sequence miRNA_ID_LIST SPOT_ID
Data table ID Species Scientific Name Annotation Date Sequence Type Sequence Source Transcript ID(Array Design) Alignments Sequence Length Sequence miRNA_ID_LIST SPOT_ID 14q0_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14q0
chr14:101364257-101364333 (+)
77
TGGACCAATGATGAGACAGTGTTTATGAACAAAAGATCATGATTAATCCAGTTCTGCACAAAACACTGAGGTCCATT
CDBox: 14q0
14qI-1_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-1
chr14:101391158-101391227 (+)
70
AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCC
CDBox: 14qI-1
14qI-1_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-1
chr14:101391158-101391227 (+)
70
AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCC
CDBox: 14qI-1
14qI-2_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-2
chr14:101393679-101393749 (+)
71
ATAGCCAATCATTAGTATTCTGAGCTGTAGGAATCAAAGATTTTGATTAGATTCTGTAACTCAGAGGTTTA
CDBox: 14qI-2
14qI-3_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-3
chr14:101396256-101396326 (+)
71
TAGACCAATGATGAGTATTCTGGGGTGTCTGAATCAATGATTTTGATTAAACCCTGTAACTCTGAGGTCCA
CDBox: 14qI-3
14qI-4_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-4
chr14:101402828-101402901 (+)
74
TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA
CDBox: 14qI-4
14qI-4_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-4
chr14:101402828-101402901 (+)
74
TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA
CDBox: 14qI-4
14qI-5_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-5
chr14:101404524-101404600 (+)
77
TGGATCAATGATGAGTATTGGTGGAGGTGTCTGAATCAACACTTTTGATTAAGCCCTCTGTGTAACTCTGAGATCTG
CDBox: 14qI-5
14qI-6_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-6
chr14:101405893-101405966 (+)
74
TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA
CDBox: 14qI-6
14qI-6_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-6
chr14:101405893-101405966 (+)
74
TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA
CDBox: 14qI-6
14qI-7_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-7
chr14:101407463-101407538 (+)
76
TGGATCAATGATGAGTATGCGTGGGGCATCTGAATCAAATATTCTGATTATACCCTGTCTGTATCTCTGAGGTCCA
CDBox: 14qI-7
14qI-8_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-8
chr14:101409788-101409860 (+)
73
TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA
CDBox: 14qI-8
14qI-8_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-8
chr14:101409788-101409860 (+)
73
TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA
CDBox: 14qI-8
14qI-9_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qI-9
chr14:101411986-101412056 (+)
71
TGGATCAATGATGAGTACCCTGGGGTGTCTGAATCTTGGATTTTGATTAAACCCTATAACTCTGAGGTCCA
CDBox: 14qI-9
14qII-10_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qII-10
chr14:101433389-101433459 (+)
71
AAGATCAATGATGACTACTGTTAGTGTATGAGTTACACATGATGAATACATGTCTGAAACTCTGAGGTCCA
CDBox: 14qII-10
14qII-10_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qII-10
chr14:101433389-101433459 (+)
71
AAGATCAATGATGACTACTGTTAGTGTATGAGTTACACATGATGAATACATGTCTGAAACTCTGAGGTCCA
CDBox: 14qII-10
14qII-11_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qII-11
chr14:101434448-101434521 (+)
74
TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-11
14qII-11_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qII-11
chr14:101434448-101434521 (+)
74
TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-11
14qII-12_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qII-12
chr14:101435285-101435358 (+)
74
TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-12
14qII-12_x_st
Homo sapiens
8-Oct-10
CDBox
Affymetrix Proprietary Database
14qII-12
chr14:101435285-101435358 (+)
74
TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-12
20715 3542 Kbytes .Supplementary data files not provided
Less...
More...