GEO Profiles Links for Nucleotide (Select 298286496) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 305

<< First< Prev

Page of 16

Next >Last >>

Select item 130010391.

Dmrtc2 - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL891, 17139 (ID_REF), GDS1359, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13001039

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1304459302.

Dmrtc2 - 4T1 breast cancer model: metastatic sub-populations

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P487004 (ID_REF), GDS5666, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 130445930

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1162703443.

Dmrtc2 - Small-molecule inhibition of BRDT effect on testis

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1214790 (ID_REF), GDS5172, NM_027732, DMRTC2 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 116270344

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553581494.

Dmrtc2 - Transcription factor STAT5b deficiency effect on the colon

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL5759, NM_027732_at (ID_REF), GDS3385, NM_027732

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 55358149

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 455932085.

Dmrtc2 - Ultrafine particles effect on ovalbumin-sensitized lungs

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL4636, 11108 (ID_REF), GDS2976, NM_027732

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 45593208

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226004226.

Dmrtc2 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_1214790 (ID_REF), GDS5341, NM_027732

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122600422

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249625397.

Dmrtc2 - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL891, 17139 (ID_REF), GDS2078, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24962539

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249392398.

Dmrtc2 - Estren effect on the uterus: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL891, 17139 (ID_REF), GDS2077, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24939239

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75036199.

Dmrtc2 - MPSS transcriptome analysis project

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL1010, GATCTATCTCCCTCCTCAGC (ID_REF), GDS868, NM_027732

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7503619

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 6197200910.

Dmrtc2 - Eset depletion effect on embryonic stem cell

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL6333, scl32946.9.1_202-S (ID_REF), GDS3599, NM_027732, Dmrtc2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61972009

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13269514411.

Dmrtc2 - Diet-induced obesity model: white adipose tissue

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1214790 (ID_REF), GDS6247, NM_027732, DMRTC2 (ORF)

DataSet type:: Expression profiling by array, transformed count, 40 samples

ID:: 132695144

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1302433912.

Dmrtc2 - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL891, 17139 (ID_REF), GDS1360, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13024339

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2064195713.

Dmrtc2 - Adenovirus vector effect on complement system deficient mutant livers

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL3222, M200015190 (ID_REF), GDS1826, NM_027732

DataSet type:: Expression profiling by array, log2 ratio, 29 samples

ID:: 20641957

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 4694490314.

Dmrtc2 - Histone H3 lysine 9 demethylase depletion effect on embryonic stem cells

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL4234, 3170739 (ID_REF), GDS3037, NM_027732

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 46944903

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13123454415.

Dmrtc2 - Snail transcription factor/ERα ligand-binding region chimeric protein effect on embryonic stem cells: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1214790 (ID_REF), GDS5807, NM_027732, DMRTC2 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131234544

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5295571916.

Dmrtc2 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL2872, 9319 (ID_REF), GDS3259, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52955719

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 633973917.

Dmrtc2 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL891, 17139 (ID_REF), GDS775, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6339739

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1770253918.

Dmrtc2 - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL891, 17139 (ID_REF), GDS1675, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17702539

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 596643919.

Dmrtc2 - High fat diet effect on aorta: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL891, 17139 (ID_REF), GDS735, NM_027732, A_51_P487004 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5966439

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12191753920.

Dmrtc2 - Embryonic fibroblast response to ectopic expression of transcription factors Oct4, Sox2, Klf4, c-Myc: time course

Annotation:: Dmrtc2, doublesex and mab-3 related transcription factor like family C2

Organism:: Mus musculus

Reporter:: GPL6246, 10551011 (ID_REF), GDS5316, NM_027732, XM_006540358, XM_006540359, AF542046, BC100434, BC138203, BC145988, chr7:24870057-24877651 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 121917539

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 298286496) (305)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 305

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity