GEO Profiles Links for Nucleotide (Select 15126723) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 980

<< First< Prev

Page of 49

Next >Last >>

Select item 864679121.

Med21 - Effect of Tet2 loss in bone marrow progenitors

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS4287, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 86467912

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1123025122.

Med21 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS5091, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112302512

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 387722123.

Med21 - Forkhead O deficiency effect on hematopoietic stem cells

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS2720, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 38772212

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1047023364.

Med21 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL6246, 10542750 (ID_REF), GDS4827, NM_025315, BC012286, BC096641, chr6:146642579-146650600 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104702336

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 241548125.

Med21 - Type II activated macrophage

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS2041, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 24154812

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 547287126.

Med21 - Evi-1 deficiency effect on hematopoietic stem cells

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS3343, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 54728712

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1311782127.

Med21 - FLT3/ITD-SmoM2 acute myeloid leukemia model: sorted bone marrow cells

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS5806, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131178212

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766757128.

Med21 - Rosiglitazone effect on streptozotocin-induced diabetic DBA/2J mice: perpheral sciatic nerve

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS4036, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 76675712

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76537009.

Med21 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAAAGTGCACTTGCTG (ID_REF), GDS878, BC012286

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7653700

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3872571210.

Med21 - Embryonic gonad development

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS2719, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 38725712

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11377440111.

Med21 - Models of rhabdomyosarcoma and undifferentiated pleomorphic sarcoma

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL8321, 1425806_a_at (ID_REF), GDS4919, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 27 samples

ID:: 113774401

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6392371212.

Med21 - Zinc finger transcription factor Gata4 inactivation effect on endothelial-derived cells

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS3663, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 63923712

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6191431213.

Med21 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS3598, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61914312

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12427041214.

Med21 - Lipopolysaccharide effect on tumor progression locus 2 kinase-deficient macrophages

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS5385, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124270412

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12683153615.

Med21 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL6246, 10542750 (ID_REF), GDS5456, NM_025315, BC012286, BC096641, chr6:146642579-146650600 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126831536

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4303861216.

Med21 - Chlamydia psittaci infection and host genetic background

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS2877, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 43038612

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5706841217.

Med21 - Aortic endothelial cell response to dominant negative PPAR gamma expression in vitro

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS3440, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57068412

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10235661218.

Med21 - Cmah knockout effect on mdx model of Duchenne Muscular Dystrophy (DMD): cardiac muscle

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS4770, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 102356612

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7217581219.

Med21 - Polyubiquitin knockout effect on testis: time course

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS3906, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 72175812

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7226881220.

Med21 - Hypoxia effect on HL-1 cardiomyocytes

Annotation:: Med21, mediator complex subunit 21

Organism:: Mus musculus

Reporter:: GPL1261, 1425806_a_at (ID_REF), GDS3908, 108098 (Gene ID), BC012286

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 72268812

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 49

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 15126723) (980)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 980

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity