 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 06, 2013 |
| Title |
Su(Hw)+CP190_RIP-seq_rep1 (EL23) |
| Sample type |
SRA |
| |
|
| Source name |
0-24hr-old Oregon-R embryos
|
| Organism |
Drosophila melanogaster |
| Characteristics |
RIP antibody: Su(HW)+CP190 (non-commercial)
replicate: 1
purified length: 35nt
similar to: EL6 (re-sequence)
adapter: TTTAACCGCGAATTCCAGC
directional: directional
machine: Illumina HiSeq
original pipeline: 1.7.0
fastqs from: Pipeline v1.7.0
|
| Treatment protocol |
Sequential immunopurifications for directional libraries were carried out essentially as described (Lei and Corces 2006) with the following modifications. Nuclear extracts purified from 0-24 h embryos supplemented with 1U/ul Rnasin were preabsorbed to an a-Su(Hw) preimmune sera crosslinked column, then bound to an a-Su(Hw) crosslinked column, washed three times with HBSMT and three times with HBSM (50 mM HEPES, pH 6.7; 150 mM NaCl; 5 mM Kcl; 2.5 mM MgCl2), eluted with 1.25 mL HBSK-100 (50 mM HEPES, pH 6.7; 150 mM NaCl; 100 mM Kcl; 2.5 mM MgCl2) and 1.25 mL HBSK-200 (50 mM HEPES, pH 6.7; 150 mM NaCl; 200 mM Kcl; 2.5 mM MgCl2). The eluates were combined and added to 2.5 mL of HBSX-BSA (50 mM HEPES, pH 6.7; 150 mM NaCl; 2.5 mM MgCl2; 0.6% TritonX-100; 2 mg/mL BSA) including protease inhibitors and 1 U/ul Rnasin, then bound to an a-CP190 crosslinked column, washed and eluted as described previously (Lei and Corces 2006). RNA copurified with 250 mM and 1M MgCl2 elutions was acid:phenol extracted, ethanol precipitated with 20 mg glycogen, and digested with Dnase I.
|
| Extracted molecule |
nuclear RNA |
| Extraction protocol |
For directional libraries, the RNA was phosphatase treated with Shrimp Alkaline Phosphatase (USB corporation), and 5' end labeled with g-[32P]-ATP and T4 polynucleotide kinase (NEB) and run on a 15% denaturing polyacrylamide gel. Bands specific to the IP, ranging from 35 nt to 55 nt, were cut, crushed with a motorized pestle and soaked in 0.3M NaOAc pH 5.2, and extracted RNA was ethanol precipitated with 20 mg glycogen. Samples were digested with RNase H (NEB) using an oligo complimentary to 2S rRNA and then digested with DNase I. Samples were acid:phenol extracted and ethanol precipitated with NH4OAc.3'dapters were ligated with T4 RNA ligase (NEB) (ATP was omitted if adenylated linkers were used), and samples were run on a 15% denaturing polyacrylamide gel and purified as before. Samples were precipitated, and 5' end labeled again with g-[32P]-ATP and T4 polynucleotide kinase. 5' adapter were ligated with T4 RNA ligase, and samples were run on a 12% denaturing polyacrylamide gel and purified and precipitated as before. Samples were reverse transcribed using Superscript III (Invitrogen) using a primer complementary to the 3'adapteand PCR amplified using Pfu Ultra (Stratagene) using primers corresponding to the 5' and 3' adapters. When non-Illumina small RNA adapters were used, libraries were adapted to Illumina compatible ends by PCR amplification. Libraries were sequenced on the Illumina Genome Analyzer I or II platforms using commercial or custom sequencing primers. For non-directional oligo-dT selected libraries, poly(A)+ RNA was selected using a MicroPoly(A)Purist column (Ambion), and 100 ng was cloned using the standard Illumina mRNA-seq v2.2 cloning protocol.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
For directional libraries, the RNA was phosphatase treated with Shrimp Alkaline Phosphatase (USB corporation), and 5' end labeled with g-[32P]-ATP and T4 polynucleotide kinase (NEB) and run on a 15% denaturing polyacrylamide gel. Bands specific to the IP, ranging from 35 nt to 55 nt, were cut, crushed with a motorized pestle and soaked in 0.3M NaOAc pH 5.2, and extracted RNA was ethanol precipitated with 20 mg glycogen. Samples were digested with RNase H (NEB) using an oligo complimentary to 2S rRNA and then digested with DNase I. Samples were acid:phenol extracted and ethanol precipitated with NH4OAc. 3' adapters (Custom: rAppTTTAACCGCGAATTCCAG/3ddC/) were ligated with T4 RNA ligase (NEB) (ATP was omitted if adenylated linkers were used), and samples were run on a 15% denaturing polyacrylamide gel and purified as before. Samples were precipitated, and 5' end labeled again with g-[32P]-ATP and T4 polynucleotide kinase. 5' adapters (Custom: tccgaaattaaccctcactaaaGrGrGrA) were ligated with T4 RNA ligase, and samples were run on a 12% denaturing polyacrylamide gel and purified and precipitated as before. Samples were reverse transcribed using Superscript III (Invitrogen) using a primer complementary to the 3'adapter (CTGGAATTCGCGGTTAAA) and PCR amplified using Pfu Ultra (Stratagene) using primers corresponding to the 5' and 3' adapters (FW: ATTAACCCTCACTAAAGGGA; REV: CATACGATTTAGGTGACACTATAG). When non-Illumina small RNA adapters were used, libraries were adapted to Illumina compatible ends by PCR amplification (FW: AATGATACGGCGACCACCGACGCTCTTCCGATCTCCGAAATTAACCCTCACTAA; REV: CAAGCAGAAGACGGCATACGACTGGAATTCGCGGTTAAA). Libraries were sequenced on the Illumina Genome Analyzer I or II platforms using commercial or custom sequencing primers (Custom: CGCTCTTCCGATCTCCGAAATTAACCCTCACTAAAGGGA).
For non-directional oligo-dT selected libraries, poly(A)+ RNA was selected using a MicroPoly(A)Purist column (Ambion), and 100 ng was cloned using the standard Illumina mRNA-seq v2.2 cloning protocol.
|
| |
|
| Submission date |
Jun 15, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Ryan Dale |
| E-mail(s) |
[email protected]
|
| Organization name |
National Institutes of Health
|
| Department |
National Institute of Child Health and Human Development
|
| Lab |
Bioinformatics and Scientific Programming Core
|
| Street address |
Rm 10D39, 10 Center Drive
|
| City |
Bethesda |
| State/province |
MD |
| ZIP/Postal code |
20892 |
| Country |
USA |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE29991 |
Messenger RNA is a functional component of a chromatin insulator complex |
|
| Relations |
| Reanalyzed by |
GSM3274768 |
| SRA |
SRX077891 |
| BioSample |
SAMN00627862 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM742283_EL23.filtered.nodups.bam |
3.0 Mb |
(ftp)(http) |
BAM |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
