|
| Status |
Public on Jul 31, 2023 |
| Title |
y w, Pngl-ex14, Pngl-ex14 replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
midgut
|
| Organism |
Drosophila melanogaster |
| Characteristics |
developmental stage: third instar larvae
strain: y w
tissue: midgut
genotype: y w; Pngl[ex14]/Pngl[ex14] (homozygous)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For each genotype, 40 midguts were dissected directly in the TRI Reagent (Millipore/Sigma, T9424) and stored at -80°C.
The samples were prepared on a Beckman Fxp using the Illumina TruSeq stranded mRNA chemistry and sequenced on a NextSeq 500 (Mid output flowcell) in paired-end mode.
|
| |
|
| Library strategy |
ssRNA-seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
yw_Png1-Ex14-2
|
| Data processing |
The raw FASTQ files were trimmed using cutadapt v1.4 with parameters "-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -q 25 -e 0.1 -m 12" was performed.
Alignment to the Drosophila dm6 genome using STAR v2.5.3 with the reference transcriptome derived from Flybase release 6_20.
Statistical testing for significance of differential expression was done using edgeR and custom R scripts.
Assembly: dm6
Supplementary files format and content: tab-delimited text file including raw counts for each sample
|
| |
|
| Submission date |
Jun 16, 2022 |
| Last update date |
Jul 31, 2023 |
| Contact name |
Benjamin Andrew Story |
| E-mail(s) |
[email protected]
|
| Organization name |
European Molecular Biology Laboratory (EMBL)
|
| Department |
Genomics
|
| Street address |
Meyerhofstrasse 1
|
| City |
Heidelberg |
| ZIP/Postal code |
69117 |
| Country |
Germany |
| |
|
| Platform ID |
GPL19132 |
| Series (1) |
| GSE206229 |
Evaluation of global gene expression changes in the larval intestines of PNGase-like (Pngl) mutant Drosophila |
|
| Relations |
| BioSample |
SAMN29132991 |
| SRA |
SRX15717469 |
