 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 28, 2021 |
| Title |
Piwi-MatKD_2_rep1_SmallRNA [THU_rep1] |
| Sample type |
SRA |
| |
|
| Source name |
Piwi-MatKD_2_whole embryo
|
| Organism |
Drosophila melanogaster |
| Characteristics |
maternal genotype: THU/MAT-Gal4
paternal genotype: w1118
tissue: 0-1.5h embryo
molecule subtype: 20-30 nucleotide RNA
|
| Growth protocol |
Approximately 100 females (UAS-shRNA) and 20 males (MAT-GAL4) were mater together in embryo collection cages with grape juice plates at 25 degrees C for at least 2 days prior to embryo collection. Embryos were collected on grape juice plates for 0-1.5h and immediately harvested for RNA extraction.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA extracted using TRIzol, then small (20-30nt) RNAs extracted by size selection on 15% polyacrylamide gel
TRIzol extraction from whole embryos, standard protocol following manufacturer's instructions
RNA-seq (stranded) or Small RNA-seq; Illumina TruSeq Small RNA Library Prep Kit or Illumina TruSeq Stranded mRNA Library Prep kits
For small RNA-seq raw data, only Read 1 analyzed and submitted because read is so short that Read 2 is the reverse complement of Read 1
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
THU_rep1
|
| Data processing |
For Total RNA-Seq: reads were mapped to D. melanogaster Berkeley Drosophila Genome Project (BDGP) release 6, and counted at transposable element and gene features, defined by gene annotation in BDGP6.28, using TETools
For Small RNA-Seq: Adapter sequence (TGGAATTCTCGGGTGCCAAGG) was trimmed from reads using CutAdapt. rRNA, miRNA, tRNA, and siRNA (according to FlyBase annotation, and including exogenous siRNAs being expressed by our RNAi lines) were filtered out, and remaining sequences were then mapped to the Drosophila genome using Bowtie (1.2.2) to create the list of putative piRNAs. To identify putative piRNA target genes on non-transposon mRNAs, these putative piRNAs were mapped using Bowtie (1.2.2) to the transcribed sequences (sequence release 6, annotation release 25; dmel-all-gene-r6.26.fasta retrieved from FlyBase) of all D. melanogastar genes, excluding transposons. Mapping required the piRNA read to be antisense to the mRNA and allowed up to 3 mismatches in the first 24 nucleotides. Featurecounts was used to count the number of piRNA reads that aligned to each mRNA, weighted for the number of mapping locations for each read.
Genome_build: BDGP6.28
Supplementary_files_format_and_content: text file contains weighted piRNA counts at each non-transposon gene in Drosophila (generated from Bowtie and Featurecounts), all replicates of all three genotypes (Small RNA-seq)
Supplementary_files_format_and_content: CSV file contains RNA-seq counts at each transposon and non-transposon gene in Drosophila (generated from TETools), all replicates of all three genotypes
|
| |
|
| Submission date |
Apr 12, 2021 |
| Last update date |
Jun 28, 2021 |
| Contact name |
Haifan Lin |
| E-mail(s) |
[email protected]
|
| Phone |
203-785-6239
|
| Organization name |
Yale University
|
| Street address |
10 Amistad Street
|
| City |
New Haven |
| State/province |
Connecticut |
| ZIP/Postal code |
06519 |
| Country |
USA |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE171951 |
Maternal Piwi regulates primordial germ cells to ensure the fertility of female progeny in Drosophila |
|
| Relations |
| BioSample |
SAMN18718039 |
| SRA |
SRX10582944 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
