 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 25, 2021 |
| Title |
SAR-seq in Muscle rep1 |
| Sample type |
SRA |
| |
|
| Source name |
iMuscle
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: muscle cell differentiated from iPSC
genotype: WT
treatment: NT
dose: NA
harvested day: day9
molecule subtype: EdU incorporated DNA
|
| Treatment protocol |
Neurons and iMuscle cells were incubated with 20 M EdU for 18 hours, unless otherwise noted.
|
| Growth protocol |
To generate skeletal muscle myoblasts from human iPSCs, we engineered a doxycycline-inducible vector harboring a MyoD1transcription factor transgene immediately followed by a co-inducible short hairpin RNA targeting Oct4 and selection marker/fluorescent proteincassette (MyoD-O iPSCs), similar to previous methods. We used the PiggyBacTM system to facilitate delivery and genome integration of thetransgene cassette. To increase transposase expression in iPSCs, we subcloned the PiggyBacTM transposase under a long version of the eF1a promoter,and co-transfected this transposase vector with the MyoD1 donor vector into iPSCs using lipofectamine stem (Thermofisher Scientific, Cat. No.STEM00015). Transfection rates were approximately 55% based on fluorescence of a co-expressed reporter gene, and we were able to obtain 100%MyoD1-O iPSCs after puromycin selection of iPSCs harboring stable integration of the transcription factor cassette. To induce myogenic differentiation, MyoD-O iPSCs were dissociated using accutase (37 C for 10 minutes) and resuspended in myogenic induction media (MIM) and plated with 3x106 iPSCs per 10 cm dish. The MyoD-O iPSCs differentiation was modified from a recent report. The MIM contained DMEM/F12 HEPES (Gibco, Cat. No. 11-330-032) supplemented to a final concentration of 1 mM sodium pyruvate, 1x MEM nonessential amino acids (NEAA) (Thermofisher Scientific, Cat. No. 11140050), 0.1 mM 2-mercaptoethanol (Gibco, Cat. No. 21985023), 10 g/mL insulin (Roche , Cat. No. 11376497001), 2 g/mL doxycycline and 10 M RI. After plating the MyoD-O iPSCs in MIM at day 0, fresh media was supplied daily until 80% confluency or more (day 6). Myoblast morphology was observed beginning at day 2 followed by myotube-like morphology at day 5. On day 6, the glycogen synthase kinase 3 (GSK-3) inhibitor, CHIR 99021, was administered for 48 hours to enhance myoblast differentiation and stimulate fusion (3 M, Tocris, Cat. No. 4423) as reported by others. At day 9 post-doxycycline, the differentiating myoblasts were harvested.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were washed with PBS, incubated with accutase for 5-10 mins, collected with a cell scrapper, pelleted at 200 × g for 5 minutes and resuspended in cold 0.1% BSA in PBS. Cold methanol was then added dropwise during slow vortexing to 80% final concentration. Samples were kept on ice for 20 minutes and then stored at -20C until processing.
Copper catalyzes azide-alkyne click chemistry. For biotin labeling via Click-iT reaction, cells were first washed 1x in PBS, permeabilized with 0.2% Triton-X100/PBS for 10 minutes on ice, and then washed 1x in PBS. Then the following were added in order: 3 mM copper sulfate (Sigma), 50 M biotin azide (ThermoFisher, Cat. No. B10184), and 1X Click-iT additive (ThermoFisher, Cat. No. C10424) for 2 hours shaking at room temperature. Cells were then washed one time in PBS and lysed in 50 mM Tris pH 8.0 with 1% SDS and Proteinase K overnight at 37°C. DNA was extracted with UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) (Invitrogen) according to manufacturer’s instructions, followed by 2.5:1 volume ethanol and 1:10 volume sodium acetate precipitation. DNA pellets were resuspended in TE buffer and sheared to 150-200 bp fragments using Covaris S220 sonicator at 10% duty cycle, 175 peak incident power, 200 cycles per burst, for 240 seconds. DNA was again precipitated by 2.5:1 volume ethanol and 1:10 volume sodium acetate and resuspended in TE buffer. Biotin-EdU fragments were pulled down using MyOne Streptavidin C1 Beads (ThermoFisher, Cat. No. 650-01). Before pulldown, 35 L of Dynabeads were washed two times with 1 mL 1X Wash and Binding buffer (1X W&B) (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 1 M NaCl, 0.1% Tween20) on a DynaMag-2 magnetic separator (Invitrogen, Cat. No. 12321D) and resuspended in 2X W&B (10 mM Tris-HCl pH8.0, 2 mM EDTA, 2 M NaCl, 0.2% Tween20). Equal volume of Dynabeads in 2X W&B were added to DNA in TE and incubated at 24°C shaking in a ThermoMixer C at 800 rpm for 30 minutes. Dynabeads bound to biotin-EdU fragments were washed three times in 1 mL of 1X W&B, two times in 1 mL EB, and one time in 1mL 1X T4 DNA Ligase Buffer (NEB). Dynabeads were resuspended in 50 L end-repair reaction mix (1X T4 DNA Ligase Buffer, 0.4 mM of dNTPs, 2.7 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB), and 1 U of Klenow fragment (NEB)) and incubated at 24°C shaking at 800 rpm for 30 minutes. Dynabeads were washed one time in 1mL 1X W&B, two times in 1mL EB, and one time in 1 mL NEBuffer 2 (NEB) and resuspended in 50 L of A-tailing reaction mix (1X NEB dA-Tailing Buffer and 20 U Klenow fragment exo- (NEB)), followed by incubation at 37°C shaking at 800 rpm for 30 minutes. Dynabeads were then washed again 1x in 1 mL NEBuffer 2 and resuspended in 115 L of ligation reaction mix (1X Quick Ligase Buffer (NEB), 6000 U Quick Ligase (NEB), 5 nM annealed TruSeq truncated adapter) and incubated at 25°C shaking at 600 rpm for 20 minutes. Ligation reaction was stopped by adding 50 mM EDTA, and Dynabeads were washed three times in 1 mL 1X W&B, three times in 1 mL EB, and finally resuspended in 8 L EB + 10 L 2X Kapa HiFI HotStart Ready Mix (Kapa Biosciences). 10 mM primers 5’-CAAGCAGAAGACGGCATACGA- GATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T-3’ and 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTACACGACGCTCTTCCGATC*T-3’ (* indicates a phosphothiorate bond and a NNNNNN TruSeq index sequence) were added with 37 L PCR reaction mix (20 L 2X Kapa HiFI HotStart Ready Mix, 17 L H2O) for final volume of 60 L. DNA was amplified using PCR program: 98°C, 45 seconds; 15 cycles [98°C, 15 seconds; 63°C, 30 seconds; 72°C, 30 seconds]; 72°C, 5 minutes. PCR products were separated from DynaBeads and cleaned using 1.8X volume AMPure Beads XP. 150-200 bp bands were isolated on 2% agarose gel and purified using QIA-quick Gel Extraction Kit (Qiagen). Prior to sequencing using Illumina NextSeq 550 (75 bp single read), library concentrations were calculated by KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems). To specifically sequence only EdU-incorporated strands of DNA (Strand-Specific SAR-seq), SAR-seq was followed exactly as above with additional steps prior to PCR amplification. After washing three times in 1 mL 1X W&B and three times in 1 mL EB post-ligation, Dynabeads were washed in 50 L 1X SSC buffer and resuspended in 20 L of 0.15 M NaOH for 10 minutes at room temperature to denature DNA strands. Beads were placed back on the DynaMag-2 magnetic separator and washed one time with 20 L 0.1 M NaOH, one time with 1 mL 1X W&B, two times with 1 mL EB, and resuspended in 8 L EB + 10 L 2X Kapa HiFI HotStart Ready Mix. Primers and PCR reaction mix were added as above.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Library strategy: SAR-seq
SAR-seq, END-seq, ChIP-seq, SEAL, and ATAC-seq reads were aligned to the reference genome (hg19 for human i3Neuron and iMuscle, mm10 for mouse pre B cells or rn6 for rat primary neurons) using bowtie (v1.1.2) with parameters -n 3 -l 50 -k 1 for END-seq and -n 2 -l 50 -m 1 for the rest. RNA-seq reads were aligned by STAR (v2.7.6a). Functions “view” and “sort” of samtools (v 1.6) were used to convert and sort the aligned sam files to sorted bam files. Bam files were further converted to bed files by the bedtools bamToBed command. Mitochondrial reads were removed in SAR-seq for intensity comparisons.
We used MACS (v1.4.3) to call SAR-seq, XRCC1 ChIP-seq and ATAC-seq peaks. SAR-seq XRCC1, and CTCF ChIP-seq peaks with >10 fold-enrichment over background were kept. Peaks of hisone modification determined by ChIP-seq peaks were called by SICER with default parameters. Peaks within blacklisted regions (https://sites.google.com/site/anshulkundaje/projects/blacklists) were filtered. As peaks of ddN S1-END-seq are always clustered, subpeaks were called by the PeakSplitter tool of PeakAnalyzer with parameters -c 15 -v 0.6.
BedGraph files were generated by bedtools genomecov, normalized by reads per million (RPM) and then converted to bigWig files using bedGraphToBigWig from UCSC pre-compiled utilities for visualization at UCSC genome browser
.
Genome_build: hg19 for human, mm10 for mourse, rn6 for rat.
Supplementary_files_format_and_content: bigwig
|
| |
|
| Submission date |
Feb 22, 2021 |
| Last update date |
Mar 25, 2021 |
| Contact name |
Wei Wu |
| Organization name |
Center for Excellence in Molecular Cell Science
|
| Department |
Center for Excellence in Molecular Cell Science
|
| Street address |
320 yueyang road
|
| City |
Shanghai |
| State/province |
Shanghai |
| ZIP/Postal code |
200031 |
| Country |
China |
| |
|
| Platform ID |
GPL21697 |
| Series (2) |
| GSE167257 |
Neuronal Enhancers are Hotspots for DNA Single-Strand Break Repair [SAR-seq] |
| GSE167259 |
Neuronal Enhancers are Hotspots for DNA Single-Strand Break Repair |
|
| Relations |
| BioSample |
SAMN18028336 |
| SRA |
SRX10151389 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5100447_SARseq_iMuscle_rep1.bw |
230.3 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
