 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 18, 2020 |
| Title |
Sample20_Dis_HEK_no_PK |
| Sample type |
SRA |
| |
|
| Source name |
Dis_HEK_no_PK
|
| Organism |
Homo sapiens |
| Characteristics |
cell line/strain: HEK293-T
tissue source: Embrionic Kidney
genotype: wild-type
sample type: Footprints from disome fraction
growth condition: DMEM with GlutaMAX, pyruvate, 10% FCS, pen/strep, 37°C, 5% CO2, humidified
treatment: no PK treatment
|
| Treatment protocol |
General information on treatments is indicated in the corresponding sample characteristics field. For detailed information, please refer to the Material and Methods of the original publication.
|
| Growth protocol |
Human cells were cultivated in the indicated temperature and growth medium (as indicated in the corresponding sample "characteristics: growth conditions" field). Cells were passaged regularly through trypsinization. For all experiments cells were seeded 18-24 hours before lysis in 15 cm2 dishes (3.5 million U2OS and 6 million HEK293-T cells) to reach 70-90% confluency at the time of harvesting. E. coli cells were cultivated in the indicated temperature and growth medium (as indicated in the corresponding sample "characteristics: growth conditions") with shaking at 120 rpm. For all experiments 200 ml of EZ-RDM were inoculated with an overnight culture to an initial OD600 of 0.05 and grown untill a cell density of OD600 = 0.4 - 0.6 was reached for harvest.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA from frozen ribosome fractions was extracted using the hot acid phenol method as described in Galmozzi and Merker et al. 2019
Libraries from isolated ribosome footprints were prepared following the previously published protocol (Galmozzi and Merker et al. 2019)
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
library strategy: Ribosome Profiling
Raw NextSeq550 sequencing files were converted with bcl2fastq2 conversion software (v2.20) to obtain single fastq files per indexed sample using following command: bcl2fastq -p16 -r4 -w4 --no-lane-splitting -R <path_to_input_folder> -o <path_to_output_folder>. Only samples 5-8 were sequenced by the DKFZ Sequencing Facility on a HighSeq2000 machine and converted to fastq files.
3' adaptor sequences were trimmed with Cutadapt (v1.13) with the following command: cutadapt --cores=4 -q20 -m23 --discard-untrimmed -O6 -a ATCGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -o <path_to_output>.fastq.gz <path_to_input>.fastq.gz For samples sequenced on HiSeq2000 following command was used: cutadapt --cores=4 -q20 -m23 --discard-untrimmed -O6 -a CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTG -o <path_to_output>.fastq.gz <path_to_input>.fastq.gz
Unique molecular identifiers (UMIs) were extracted from each read for the downstream analysis using a custom Julia script (available as supplement information of this study) with the following command: julia <path_to_script>/Script1.jl <path_to_input>.fastq.gz <path_to_output>.fastq.gz --umi3 5 --umi5 2. Only samples 5-8 did not contain UMI sequences in the adaptors, therefore this step was not included for U2OS samples.
For removal of human rRNA contaminants, sequenced libraries were aligned to rRNA sequences including: RNA45SN1 - RNA45SN5 (human 28S, 18S, 5.8S), RNA5S1 (human 5S), MTRNR2L10 (Mito 16S), MT-RNR1 (Mito 12S), MT-RNR2U1 (Mito 16S), 22 mito tRNAs, 631 nuclear human tRNAs. The E. coli rRNA file included: 5S rRNA (rrfA - rrfH), 16S rRNA (rrsA, rrsB, rrsC, rrsD, rrsE, rrsG, and rrsH), 23S rRNA (rrlA, rrlB, rrlC, rrlD, rrlE, rrlG, and rrlH). All rRNA contaminations were removed by Bowtie2 (v.2.3.5.1) with the following command: bowtie2 -p4 -t -x <path_to_folder_with_Bowtie-indexed_rRNA_contamination> -q <path_to_input_file>.fastq.gz' --un <path_to_output_file>.fastq -S /dev/null
Reads that did not align to rRNA were aligned to the human genome (GRCh38p10) or E.coli genome (GCA_000022665.2, E. coli BL21(DE3), including additional chromosome files containing custom plasmid sequences, see the corresponding sample description field) using STAR (v2.7.1a) with the following command: STAR --runThreadN 24 --genomeDir <path_to_indexed_genome> --readFilesIn <path_to_input>.fastq --outFilterMultimapNmax 1 --outFilterType BySJout --alignIntronMin 5 --outFileNamePrefix <path_to_output> --outReadsUnmapped Fastx --outSAMtype BAM SortedByCoordinate --outSAMattributes All XS --quantMode GeneCounts --twopassMode Basic
All reads aligning to the coding sequence (CDS) were assigned (a-, p-, e-site) via a custom Julia script (available as supplement information of this study). p-site assigned reads were used for all downstream analysis.This script accounts for soft-clipping via the '-c 1' option: the integer indicates the bases at the 5' end that often arise from untemplated addition by the reverse transcriptase during library preparation by using the following command: julia <path_to_script>/Script2.jl -c 1 -g <path_to_genome_annotation>.gff' -u -o <path_to_output> <path_to_input>.bam
Genome_build: Human genome (GRCh38p10), E.coli genome (GCF_000009565.1, E. coli BL21(DE3))
Supplementary_files_format_and_content: Processed data are stored in HDF5 files. Each HDF5 file contains one data set per gene. Each data set consists of a 2-row matrix, with the first row containing the 1-based position within the CDS, and the second row the number of detected P-site reads at this position. Additional information is stored in the data set attributes, including: gene and protein names, transcript isoform used for position assignment, length of the coding sequence, chromosome and strand location of the gene. In this study the p-side assignments stored in such HDF5 files were further analyzed using RiboSeqTools (available at: https://github.com/ilia-kats/RiboSeqTools).
|
| |
|
| Submission date |
Jun 07, 2020 |
| Last update date |
Dec 18, 2020 |
| Contact name |
Kai Fenzl |
| E-mail(s) |
[email protected]
|
| Organization name |
ZMBH
|
| Lab |
Prof. Bernd Bukau
|
| Street address |
INF 282
|
| City |
Heidelberg |
| ZIP/Postal code |
69115 |
| Country |
Germany |
| |
|
| Platform ID |
GPL21697 |
| Series (1) |
| GSE151959 |
Nascent chain interactions of proximal ribosomes drive homo-oligomer assembly |
|
| Relations |
| BioSample |
SAMN15160135 |
| SRA |
SRX8489859 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4594359_Dis_HEK_no_PK.h5 |
53.4 Mb |
(ftp)(http) |
H5 |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
