GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2864615

Query DataSets for GSM2864615

Status

Public on Jul 01, 2018

Title

TruSeq_miRXplore

Sample type

SRA

Source name

Miltenyi Biotec (130-093-521)

Organism

synthetic construct

Characteristics

tissue: synthetic construct

Extracted molecule

total RNA

Extraction protocol

RNA samples were obtained from Miltenyi Biotec (miRXplore reference pool #130-093-521) and from ThermoFisher (human brain total RNA AM7962)
Experiments with NEBNext (NEB), TruSeq (Illumina), NEXFlex (Bioo Scientific), QIAseq (Qiagen), SMARTer (Takara Bio), and RealSeq-AC (Somagenics) were performed following the manufacturer's’ recommendations. For all kits, 1 pmol of the miRXplore Universal Reference (Miltenyi Biotec #130-093-521) was used as input to test accuracy in detection. 1 μg of brain total RNA (ThermoFisher #AM7962) was used for all kits with the exception of QIAseq, where 500 ng of total RNA was used as per the manufacturer’s recommendations. Independent libraries were prepared in technical triplicates with the same input for all experiments, with the exception of NEXTFlex brain that was performed in duplicate. The number of PCR cycles for each library was determined as per the manufacturer’s recommendations. To determine concentration and quality of libraries, all libraries were analyzed with an Agilent D1000 ScreenTape on a 2200 TapeStation instrument (Agilent), and then quantified with a Qubit dsDNA BR Assay kit on a Qubit 3.0 instrument.

Library strategy

miRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina MiSeq

Description

synthetic RNA oligonucleotides
Triplicate libraries with 1 pmol of Miltenyi Biotec miRXplore pool (130-093-521) prepared with TruSeq Small RNA (Illumina #RS-200-0012)
Libraries were amplified with 11 cycles of PCR
[processed data files:]
miRXplore_bias_ratios_v2.csv
hc_hsa_miRBase_bias_ratios_v2.csv
Each library was made from the same input RNA source. This GSM is associated with 3 SRR that represents each technical replicate.

Data processing

Basecalling performed by Illumina RTA 1.18.54. Reads demultiplexed by MiSeq instrument. Reads trimmed of adapter with cutadapt with the following specifications: For TruSeq and RealSeq libraries: cutadapt -a TGGAATTCTCGGGTGCCAAGG -m 15; For NEBNext libraries: cutadapt -a AGATCGGAAGAGCACACGTCT -m 15; For NEXTFlex libraries: cutadapt -u 4 -a NNNNTGGAATTCTCGGGTGCCAAGG -m 15; For SMARTer libraries: cutadapt -u 3 -a AAAAAAAAAA -m 15; For QIASeq libraries: cutadapt -a AACTGTAGGCACCATCAAT -m 15 Reads were mapped to a bowtie2 index created from miRXplore sequences (Miltanyi Biotec), to bowtie2 index created from high confidence human miRNAs (miRBase 21), or to bowtie2 index created from the complete set of human miRNAs (miRBase 21); Mapping was performed by using bowtie2 with the following parameters: bowtie2 -L8 --local. Raw counts of reads were obtained from sam files, by using samtools and picard-tools. Raw reads were normalized to ‘Reads per million of miRNA reads’ for each processed data file. The ratio of observed/expected (miRXplore_bias and hc_hsa_miRBase_bias) or kit1/kit2 (hc_miRNAs_brain) was calculated from the mean of triplicate experiments; the log(2) of this ratio was used for further analysis.
Genome_build: hg19
Supplementary_files_format_and_content: All processed data files are tab separated files. ‘miRXplore_bias_ratios’ and hc_hsa_miRBase_bias_ratios’ contain the log2 ratios of observed/expected, calculated from the ‘Reads per million of miRNA reads’; ‘hc_miRNAs_brain’ and ‘High_coverage_brain’ contain the ‘Reads per million of miRNA reads’.

Submission date

Nov 24, 2017

Last update date

Jul 01, 2018

Contact name

Sergio Barberan-Soler

E-mail(s)

[email protected]

Phone

8314267700

Organization name

Somagenics Inc