|
| Status |
Public on Feb 13, 2017 |
| Title |
small RNA-seq_ade6-5'TNI wt |
| Sample type |
SRA |
| |
|
| Source name |
small RNA sequencing from strain expressing siRNAs targeting an inserted non-splicable antisense cox4 intron in the ade6 5'UTR in wt background.
|
| Organism |
Schizosaccharomyces pombe |
| Characteristics |
strain: SPB2496
genotype/variation: h- leu1-32 ura4-D18 ade6-target5 nmt1+::ura4-hp+-nat
genotype/variation: expressing siRNAs targeting an inserted non-splicable antisense cox4 intron in the ade6 5'UTR in wt background.
molecule subtype: size selected small RNA from whole cell lysate
illumina barcode: ACTTGA
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from exponentially growing cells using hot phenol. The RNA was fractionated using RNeasy Midi columns (Qiagen). The flow-through fraction was precipitated and aliquots of 25 ug were separated by 17.5% PAGE to isolate the 18–28-nucleotide fraction.
Libraries were prepared using the Illumina TruSeq small RNA kit according to manufacturers instructions. For barcodes, see sample characteristics.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
ade6-5'TNI wt
|
| Data processing |
Samples were pooled and sequenced on an Illumina HiSeq 2500 instrument.
Demultiplexing and fastq conversion were performed with bcl2fastq2 v1.17.
Illumina 3' adaptors were trimmed using cutadapt with parameters -a TGGAATTCTCGGGTGCCAAGG --discard-untrimmed -m 18.
Fastq files were aligned to the S. pombe genome using Bowtie 1.0.0 with parameters -M 1 -v 0 --best --strata.
Bowtie sam out put was converted to bam using samtools (v1.3.1). Bam files were converted to bed using bedtools bamtobed (v2.25.0), Bed files were used to calculate strand-specific coverage using bedtools genomecov (v2.25.0) and resulting bedgraph files were converted to bigWig format using bedGraphToBigWig (v4).
Genome_build: S. pombe ASM294v2.24
Supplementary_files_format_and_content: bigWig files containing normalized (to 1 mio genome mapping reads per library) genome mapping read counts for visualization in UCSC or IGV.
|
| |
|
| Submission date |
Oct 05, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Fabio Mohn |
| E-mail(s) |
[email protected]
|
| Organization name |
Friedrich Miescher Institute for Biomedical Research
|
| Lab |
Buehler Lab
|
| Street address |
Maulbeerstrasse 66
|
| City |
Basel |
| ZIP/Postal code |
4058 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL17225 |
| Series (1) |
| GSE87672 |
The RNA-induced transcriptional silencing complex is targeted to chromatin exclusively via base-pairing interactions with nascent transcripts |
|
| Relations |
| BioSample |
SAMN05868084 |
| SRA |
SRX2215583 |
