GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1467756

Query DataSets for GSM1467756

Status

Public on Feb 13, 2017

Title

3_25C_zt15

Sample type

SRA

Source name

3’ RNA-Seq (without RNase H treatment)

Organism

Drosophila melanogaster

Characteristics

strain: Canton S
tissue: head
temperature tested: 25C
time point: zt15

Growth protocol

Drosophila Canton S (CS) wild type flies were reared at 25 °C on a standard diet (yeast: 38gr/L, Yellow corn mill: 91gr/L, agar: 10gr/L, molassas: 8.7% v/v, propanoic acid (BioLab): 0.9% v/v, Tegasept solution (Sigma-Aldrich; 300g/L in EtOH (BioLab)): 0.8% v/v)). Flies were kept in 12-h light:12-h dark cycles at 25 °C.

Extracted molecule

polyA RNA

Extraction protocol

For RNA extraction, new-born flies were entrained for three days in 12:12 light:dark conditions at one of the different temperatures tested (18C, 25C or 29C) and collected at one of the time points (ZT3,ZT7,ZT9,ZT11,ZT15,ZT19,ZT21 or ZT23). RNA was extracted using Trizol (Invitrogen).
ExoCAGE: 50ng-1ug of total RNA was polyA selected using Oligo-dT beads (Invitrogen) and then fragmented using Ambion Fragmentation buffer using incubation time of 1 min 50sec at 70C. Fragmented RNA was then cleaned-up using 2.5X volume on SPRI beads (Agencourt), PNK treated (T4 PNK, NEB) and incubated with Terminator Exonuclease (Epicentre) for 70 minutes. Reaction mixture was dephosphorylated with FastAP (Fermentas), cleaned (2.5X SPRI) and then lygated to a linker1 (5Phos/AXXXXXXXXAGATCGGAAGAGCGTCGTGTAG/3ddC/, XXXXXXXX is an internal barcode specific for each sample,) using T4 RNA ligase I (NEB). Ligated RNA was cleaned-up by Silane beads (Dynabeads MyOne, Life Technologies) and pooled into a single tube. RT was then performed for the pooled sample, with a specific primer (5´-CCTACACGACGCTCTTCC-3´) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then, RNA-DNA hybrids were degraded by incubating the RT mixture with 10% 1M NaOH (e.g. 2ul to 20ul of RT mixture) at 70C for 12 minutes. pH was then normalized by addition of corresponding amount of 0.5M AcOH (e.g. 4ul for 22 ul of NaOH+RT mixture). The reaction mixture was cleaned up using Silane beads and second lygation was performed, where 3’end of cDNA was lygated to linker2 (5Phos/AGATCGGAAGAGCACACGTCTG/3ddC/) using T4 RNA ligase I. The sequences of linker1 and linker2 are partially complementary to the standard Illumina read1 and read2/barcode adapters, respectively. Reaction Mixture was cleaned up (Silane beads) and PCR enrichment was set up using enrichment primers 1 and 2 (5’- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’, 5’-CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGAC GTGTGCTCTTCCGATCT-3’, where XXXXXXX is barcode sequence) and Phusion HF MasterMix (NEB). 10-12 cycles of enrichment were performed depending on the initial input amount of RNA. After clean-up with 0.8X volume of SPRI beads library was ready for characterization by Bioanalyzer.
3’ RNase H-sequencing: 50ng-1ug of total RNA was fragmented using NEBNext magnesium RNA fragmentation module (NEB) with incubation time of 2 minutes at 94C. Fragmented RNA was cleaned-up using 2.5X volume on SPRI beads (Agencourt), and then subjected to PolyA selection using Oligo-dT beads (Invitrogen). PolyA+ RNA was incubated with oligoDT primer (Fermentas) and polyA tails were digested by RNAseH (NEB) treatment for 1 hour at 37C. RNA was then cleaned (Silane beads), dephosphorylated with FastAP (Fermentas), cleaned (Silane beads) and lygated to a linker1 using T4 RNA ligase I (NEB). Ligated RNA was cleaned-up by Silane beads (Dynabeads MyOne, Life Technologies) and pooled into a single tube. Library preparation was then processed in the same way as in ExoCAGE protocol starting with RT step and so on.
3’ RNA-Seq without RNase H treatment: 50ng-1ug of total RNA was fragmented using NEBNext magnesium RNA fragmentation module (NEB) with incubation time of 5 minutes at 94C. Fragmented RNA was cleaned-up using 2.5X volume on SPRI beads (Agencourt), dephosphorylated with FastAP (Fermentas), cleaned (2.5X SPRI) and then ligated to a linker1 using T4 RNA ligase I (NEB). Ligated RNA was cleaned-up by Silane beads (Dynabeads MyOne, Life Technologies) and pooled into a single tube. The pooled sample was then subjected to poly(A) selection using Oligo(dT) beads (Invitrogen). Library preparation was then processed in the same way as in the ExoCAGE protocol starting with RT step and so on.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2000

Description

processed data file: 3_false.merged.tdf, 3_true.merged.tdf

Data processing

Illumina Casava1.7 software used for basecalling.
Sequenced reads were trimmed for adaptor sequence, and masked for low-complexity or low-quality sequence, then mapped to dm3 whole genome and transcriptome using tophat2
peaks were called using our a stand alone java program build to analyze our novel sequencing method
Genome_build: dm3
Supplementary_files_format_and_content: All 3’ without RNaseH treatment data was divided to true and false based on whether or not the 3 last bases of the first read were adenines or not (in order to separate internal poly(A) tracts and poly(A) tails). TDF files were created by IGVtools with the parameters igvtools -count -w 5. Wig files were created using a customized python scripts, where for each genomic position we counted the number of read that started on this position (i.e. the first base of the read was aligned to this position). For every sequencing method (ExoCAGE, 3’-sequencing and RNaseH sequencing) the data from different temperatures and time points were merged together to create the processesed files.

Submission date

Aug 08, 2014

Last update date

May 15, 2019

Contact name

Shaked Afik

E-mail(s)

[email protected]

Organization name

UC Berkeley

Department

Computational Biology Graduate Group