 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 30, 2016 |
| Title |
CLIP_OrbF_WT_replicate_2 |
| Sample type |
SRA |
| |
|
| Source name |
CLIP S2 cells
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell type: S2 cells
|
| Treatment protocol |
250μM CuSO4, 300 μg/ml hygromycin B, PAR CLIP 4-SU treatment (Hafner et al., Cell 2010)
|
| Growth protocol |
27°C, 5% CO2, Schneider's Drosophila medium + 10% FCS +PenStrep
|
| Extracted molecule |
total RNA |
| Extraction protocol |
iCLIP (König et al., Nat. Struct. Mol. Biol. 2010)
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
sequenced strained (https://stockcenter.ucsd.edu)
|
| Data processing |
Basecalling was performed using Real-Time Analysis (RTA) version > 1.12.4.2 or CASAVA 1.9.1.
RNA-seq:
Reads were mapped to the dm3 genome and transcriptome using bowtie (bowtie -f -v 3 -m 1 --best --strata --quiet -S INDEX -) and bfast reconciling the outputs. We estimated RPKM values for each gene based on the number of reads falling over each exon merging exons from all genes' isoforms into one meta-transcript. Reads counts were normalized by the total reads per library and the merged meta-gene exons lengths.
PAR/iCLIP:
Reads were first processed by a series of filters before the alignment step: (i) remove bases with Phred quality score < 13 from the 3' end, (ii) collapse identical sequences (putative PCR duplicates), (iii) trim off 10bp linker sequences from the 5' end (contains a random 4bp random sequences to sort out PCR duplicates), (iv) remove adapter sequence (AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG) from the 3' end using cutadapt (Marcel Martin, EMBnet.journal 2011) (v) remove low complexity and N containing reads and (vi) remove reads matching to ribosomal sequences. After these filters, reads that were longer than 15bp were mapped to the dm3 genome using novoalign (-d INDEX -f READS.FA -F FA -t 90 -l 25 -s 1 -o SoftClip -r None). Mapped reads from different replicate sequencing runs (e.g. rep1a, rep1b) were merged. Using an in-house developed pipeline, CLIP binding clusters where called from overlapping reads and scored by the fraction of T>C conversions and their contribution to a single locus. In addition, putative binding sites were predicted using PARalyzer (Corcoran et al., Genome Biol. 2011). Read density profiles were computed from mapped reads and normalized to 1 million mapped reads per library.
Genome_build: dm3
Supplementary_files_format_and_content: Processed RNA-seq data is stored as text files with FlyBase gene identifiers, gene names, and CG numbers and the associated RPKM expression value for each library. For the CLIP libraries, read density profiles normalized to 1 million mapped reads are provided.
|
| |
|
| Submission date |
Jul 21, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Daniel Gerlach |
| E-mail(s) |
[email protected]
|
| Organization name |
Boehringer Ingelheim RCV GmbH & Co KG
|
| Department |
Global Computational Biology and Digital Sciences
|
| Street address |
Dr.-Boehringer-Gasse 5-11
|
| City |
Vienna |
| ZIP/Postal code |
1121 |
| Country |
Austria |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE59611 |
RNA-binding profiles of Drosophila CPEB proteins Orb and Orb2 |
|
| Relations |
| BioSample |
SAMN02928430 |
| SRA |
SRX657915 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1440386_CLIP_OrbF_WT_replicate_2.wig.gz |
5.4 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
