|
| Status |
Public on May 10, 2013 |
| Title |
smallRNAs (18-29nt) from UAS-Dcr-2;NGT;nanosGAL4>w- |
| Sample type |
SRA |
| |
|
| Source name |
smallRNAs (18-29nt) from UAS-Dcr-2;NGT;nanosGAL4>w-
|
| Organism |
Drosophila melanogaster |
| Characteristics |
tissue: fly ovaries
genotype: UAS-Dcr-2;NGT;nanosGAL4>w-
Stage: from 5-6 days old flies
|
| Treatment protocol |
OSC were transfected twice with siRNAs and analyzed after 4 days
|
| Growth protocol |
flies were grown at 25 degrees; OSC were grown at 27 degrees on M3 medium
|
| Extracted molecule |
total RNA |
| Extraction protocol |
total RNA was isolated with Trizol
small-RNAs were cloned as described in Brennecke et al. 2009
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
small RNA
|
| Data processing |
basecalled with the instruments RTA (Run time analysis version 1.12.48.0): SCS (PN:RTA DS:Controlling software on instrument VN:1.13.48.0)
fastq files were adapter 'AGATCGGAAGAGCACACGTCT' clipped using cutadapt, version 1.0, default settings
after adapter removal, the first and last 4 bases were trimmed (both linkers contain 4 random nucleotides at their respective termini) from sequence as well using HomerTools, version 3.9
reads matching the release5 genome sequence of D. melanogaster were the basis for the processed data file
Genome_build: Release 5 (dm3)
|
| |
|
| Submission date |
Apr 09, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Dominik Handler |
| E-mail(s) |
[email protected]
|
| Organization name |
IMBA-Institute of Molecular Biotechnology of Austrian Academy of Sciences
|
| Lab |
Brennecke
|
| Street address |
Dr. Bohr-Gasse 3
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL13304 |
| Series (1) |
| GSE45894 |
The genetic framework of the Drosophila piRNA pathway |
|
| Relations |
| SRA |
SRX262877 |
| BioSample |
SAMN02010579 |
