Submitter | Handle | TOPMED | Submitter SNP ID | TOPMed_freeze_8?chr11_10,577,656 | RefSNP(rs#) | clustering in process | Submitted Batch ID | Freeze 8 variant calls-chr11 | Submitted Date | Nov 20, 2020 | Publication Cited | N.D. | First entry to dbSNP | Nov 20 2020 12:00:00:000AM |
| Resource Links | Submitted Gene Name | N.D | Submitted Gene ID | N.D. | Submitted SNP Synonyms | N.D | Submitted linkout | N.D |
| | Allele | Observed Allele | AGAAGCGGAGAGCTCAAATTTTGA/- | Ancestral Allele | N.D. | Allele Origin | N/A | SNP Class | DIV | CpG Code | N.D. |
| Validation | Validation Status | Not Validated | HWE Goodness of Fit | not applicable | Homozygote Detected | | PCR Confirmed | | In Expressed Sequence | |
| Variation | Frequency Submission | N.D. | Genotype Summary | N.D. | Genotype Submission | N.D. | Haplotype | N.D. |
|
>gnl|dbSNP|ss4875077290|allelePos=26|len=51|taxid=9606|alleles='AGAAGCGGAGAGCTCAAATTTTGA/-'|mol=Genomic ACAGCAATGA CCAAGCCATT GGCTG
N
GGTAGCAGAA AATGCATGAC TAACA
There is no frequency submission for ss4875077290.
No sufficient data to compute Hardy-weinberg probability for ss4875077290.
There is no individual genotype data for ss4875077290.
|