Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: UHA47002.1
Identical Proteins FASTA Graphics
LOCUS UHA47002 219 aa linear INV 31-DEC-2022 DEFINITION cytochrome c oxidase subunit I, partial (mitochondrion) [Parapanteles hyposidrae]. ACCESSION UHA47002 VERSION UHA47002.1 DBSOURCE accession OL889769.1 KEYWORDS . SOURCE mitochondrion Parapanteles hyposidrae ORGANISM Parapanteles hyposidrae Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Ichneumonoidea; Braconidae; Microgastrinae; Parapanteles. REFERENCE 1 (residues 1 to 219) AUTHORS Zhou,X.G., Tang,P. and Xiao,Q. TITLE Direct Submission JOURNAL Submitted (16-DEC-2021) Tea Cultivation Engineering Research Center, Tea Research Institute, Chinese Academy of Agricultural Sciences, 9 South Meiling Road, Hangzhou, Zhejiang 310008, China COMMENT Method: conceptual translation. FEATURES Location/Qualifiers source 1..219 /organism="Parapanteles hyposidrae" /organelle="mitochondrion" /isolate="h44" /host="Ectropis obliqua (Prout)" /db_xref="taxon:2897434" /geo_loc_name="China: Wuxi, Jiangsu" /collection_date="2021" /PCR_primers="fwd_seq: attcaaccaatcataaagatattgg, rev_seq: taaacttctggatgtccaaaaaatca" Protein <1..>219 /product="cytochrome c oxidase subunit I" Region 1..>219 /region_name="Heme_Cu_Oxidase_I" /note="Heme-copper oxidase subunit I. Heme-copper oxidases are transmembrane protein complexes in the respiratory chains of prokaryotes and mitochondria which catalyze the reduction of O2 and simultaneously pump protons across the membrane. The superfamily is...; cl00275" /db_xref="CDD:469701" Site order(3,64,75,82,85,140..141,147,151) /site_type="active" /note="D-pathway [active]" /db_xref="CDD:238461" CDS 1..219 /gene="COX1" /coded_by="OL889769.1:<1..>658" /codon_start=2 /transl_table=5 ORIGIN 1 mlyfmfglws gmlgfsmsli irlelgmpgs ligndqiyns mvtshafimi ffmvmpvmig 61 gfgnwliplm lgspdmsfpr mnnmsfwlli pslfllilsg fintgvgtgw tvypplslvl 121 ghggmsvdlg ifslhlagas simgavnfit tilimrtnlf lmdkmslfsw svfitailll 181 lslpvlagai tmlltdrnln tsffdpsggg dpilyqhlf //
Whole sequence Selected region from: to:
Conserved Domains
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on