GEO Profiles Links for Nucleotide (Select 594542521) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 303

<< First< Prev

Page of 16

Next >Last >>

Select item 596254061.

Acer2 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2629112 (ID_REF), GDS3522, NM_139306

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59625406

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824508062.

Acer2 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2629112 (ID_REF), GDS3720, NM_139306

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82450806

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1263311133.

Acer2 - Lung from cigarette smoke-related chronic obstructive pulmonary disease model: time course

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2629112 (ID_REF), GDS5438, NM_139306

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 126331113

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299169604.

Acer2 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2629112 (ID_REF), GDS5651, NM_139306, ASAH3L (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129916960

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625701115.

Acer2 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6333, scl0230379.5_233-S (ID_REF), GDS3621, NM_139306, CRG-L1 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62570111

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1298206606.

Acer2 - Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2629112 (ID_REF), GDS5648, NM_139306, ASAH3L (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 129820660

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1056437817.

Acer2 - Acute cold exposure effect on brown adipose tissue

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2629112 (ID_REF), GDS4850, NM_139306

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 105643781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 998796788.

Acer2 - Leukemia inhibitory factor neutralization effect on E. coli pneumonia lung

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL11078, 230379_at (ID_REF), GDS4583, NM_139306

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 99879678

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1067726999.

Acer2 - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10505779 (ID_REF), GDS4898, NM_001290541, NM_139306, AF282864, AY312515, BC059819, NM_001290543, chr4:86874414-86920875 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106772699

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11939079310.

Acer2 - Chronic, low level drug exposure effect on obese liver

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P244408 (ID_REF), GDS5258, NM_139306, A_51_P244408 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119390793

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10659889911.

Acer2 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10505779 (ID_REF), GDS4893, NM_001290541, NM_139306, AF282864, AY312515, BC059819, NM_001290543, chr4:86874414-86920875 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106598899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11374456112.

Acer2 - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL11533, 10505779 (ID_REF), GDS4918, NM_139306, AF282864, chr4:86520318-86566779 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113744561

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8750019913.

Acer2 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10505779 (ID_REF), GDS4317, NM_001290541, NM_139306, AF282864, AY312515, BC059819, NM_001290543, chr4:86874414-86920875 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87500199

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12258248114.

Acer2 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2629112 (ID_REF), GDS5341, NM_139306

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122582481

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11730489915.

Acer2 - Lung tumors arising from Wnt/beta-catenin signaling activation and constitutively active Kras mutant

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10505779 (ID_REF), GDS5201, NM_001290541, NM_139306, AF282864, AY312515, BC059819, NM_001290543, chr4:86874414-86920875 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 117304899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12788061316.

Acer2 - White adipose tissue development

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2629112 (ID_REF), GDS5528, NM_139306

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 127880613

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752786617.

Acer2 - MPSS transcriptome analysis project

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAACATGGCTCTGTGA (ID_REF), GDS868, NM_139306

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7527866

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 6226566018.

Acer2 - Claudin16 deficiency effect on kidneys

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2629112 (ID_REF), GDS3612, NM_139306, ASAH3L (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 62265660

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10643629919.

Acer2 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10505779 (ID_REF), GDS4886, NM_001290541, NM_139306, AF282864, AY312515, BC059819, NM_001290543, chr4:86874414-86920875 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106436299

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6668198320.

Acer2 - Intratracheal lipopolysaccharide (IT LPS)-induced lung injury effect on Rag-1 null, lymphocyte-deficient mutants

Annotation:: Acer2, alkaline ceramidase 2

Organism:: Mus musculus

Reporter:: GPL4865, scl0230379.5_233-S (ID_REF), GDS3749, NM_139306

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 66681983

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 16

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 594542521) (303)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 303

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity