GEO Profiles Links for Nucleotide (Select 4805032) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 35

<< First< Prev

Page of 2

Next >Last >>

Select item 932489081.

Kcnj2 - Endothelial cells from P8 neonatal retina [MG_U74Cv2]

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS4463, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93248908

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 571926082.

Kcnj2 - Embryonic stem cell response to STAT3 overexpression in vitro (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS3446, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57192608

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 553031083.

Kcnj2 - Visual cortex during the critical period for ocular dominance (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS3382, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55303108

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 549129084.

Kcnj2 - STAT5 depleted pro-B cell line response to IL-3: time course (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS3351, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 54912908

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 447879085.

Kcnj2 - Pancreatic development (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS2950, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 44787908

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 303565086.

Kcnj2 - Acute myocardial infarction model: time course (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS2331, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 66 samples

ID:: 30356508

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 295279087.

Kcnj2 - Uniparental duplication of chromosome 7 regions effect on various tissues (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS2285, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 29527908

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273998088.

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS2186, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 27399808

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273251089.

Kcnj2 - Type 1 diabetes model: autoimmune target organs (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS2179, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27325108

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 2359640810.

Kcnj2 - Lupus-prone BWF1 males and females: spleen (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS2013, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 23596408

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2324580811.

Kcnj2 - Airway disease trait manifestation in various genetic backgrounds: lungs (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1988, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23245808

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2322060812.

Kcnj2 - Primary visual cortex response to visual input deprivation (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1986, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23220608

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2242440813.

Kcnj2 - Positively selected H-2b T cell receptor transgenic thymocytes (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1936, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 22424408

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2150840814.

Kcnj2 - Myotube response to PGC-1alpha induced mitochondrial biogenesis: time course (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1880, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 21508408

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1736110815.

Kcnj2 - Dendritic cell subpopulations: spleen (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1658, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 17361108

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1697870816.

Kcnj2 - Osteoblast differentiation (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1633, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 16978708

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1649810817.

Kcnj2 - Follicular dendritic cell enriched splenocytes (MG U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1600, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 16498108

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1265540818.

Kcnj2 - T cell anergy induction regulation by Egr-2 and Egr-3 (MG-U74C)

Annotation:: Kcnj2, potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL83, 134778_at (ID_REF), GDS1339, 16518 (Gene ID), AI666678

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 12655408

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761920519.

Kcnj2 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Kcnj2, Potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTAGCCTTTGACAATC (ID_REF), GDS878, AI666678

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7619205

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 748150520.

Kcnj2 - MPSS transcriptome analysis project

Annotation:: Kcnj2, Potassium inwardly-rectifying channel, subfamily J, member 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTAGCCTTTGACAATC (ID_REF), GDS868, AI666678

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7481505

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 4805032) (35)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 35

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity