GEO Profiles Links for Nucleotide (Select 47059107) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 363

<< First< Prev

Page of 19

Next >Last >>

Select item 258560561.

Fjx1 - Developing mammary gland: terminal end buds and ducts

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL2660, 5056 (ID_REF), GDS2115, NM_010218

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25856056

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756884212.

Fjx1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6481, 101770722 (ID_REF), GDS4002, NM_010218, Fjx1 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75688421

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756683383.

Fjx1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6481, 3390035 (ID_REF), GDS4002, NM_010218, Fjx1 (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75668338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 662079344.

Fjx1 - X chromosome dosage model

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2689998 (ID_REF), GDS3728, NM_010218

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66207934

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625745725.

Fjx1 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6333, scl18949.1_10-S (ID_REF), GDS3621, NM_010218, Fjx1 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62574572

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74834346.

Fjx1 - MPSS transcriptome analysis project

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGAAGAAACTGGCTGC (ID_REF), GDS868, NM_010218

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483434

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 735765697.

Fjx1 - Rho kinase inhibitor fasudil effect on forebrain astrocyte culture: time course

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2737416 (ID_REF), GDS3944, NM_010218

DataSet type:: Expression profiling by array, transformed count, 32 samples

ID:: 73576569

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 808766848.

Fjx1 - Dopaminergic transcription factors Ascl1, Lmx1a, Nurr1 combined effect on embryonic fibroblasts

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10485402 (ID_REF), GDS4155, NM_010218, BC051990, chr2:102449366-102451792 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 80876684

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625745719.

Fjx1 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6333, scl0014221.2_140-S (ID_REF), GDS3621, NM_010218, Fjx1 (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62574571

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7282980810.

Fjx1 - Spatial and temporal development of mammalian salivary glands

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P355589 (ID_REF), GDS3922, NM_010218, A_51_P355589 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72829808

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 6530763311.

Fjx1 - Addictive drugs effect on brain striatum: time course

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2737416 (ID_REF), GDS3703, NM_010218

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65307633

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12759056912.

Fjx1 - Progranulin deficiency effect on various brain regions: time course

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2737416 (ID_REF), GDS5501, NM_010218

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127590569

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 5296769313.

Fjx1 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL2872, 21293 (ID_REF), GDS3259, NM_010218, A_51_P355589 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52967693

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7191086914.

Fjx1 - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2737416 (ID_REF), GDS3900, NM_010218

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71910869

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11592465715.

Fjx1 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2689998 (ID_REF), GDS5157, NM_010218, FJX1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115924657

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6160695716.

Fjx1 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2689998 (ID_REF), GDS3582, NM_010218, FJX1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61606957

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6530763417.

Fjx1 - Addictive drugs effect on brain striatum: time course

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2689998 (ID_REF), GDS3703, NM_010218

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65307634

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7462955718.

Fjx1 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2689998 (ID_REF), GDS3974, NM_010218, FJX1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74629557

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13173505719.

Fjx1 - αSMA+ myofibroblast early depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2689998 (ID_REF), GDS5820, NM_010218, FJX1 (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131735057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9181516920.

Fjx1 - Oxidative stress effect on ATF4 knockout embryonic neurons

Annotation:: Fjx1, four jointed box 1 (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6100, 3390035 (ID_REF), GDS3311, NM_010218

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 91815169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 19

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 47059107) (363)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 363

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity