GEO Profiles Links for Nucleotide (Select 28386123) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 158

<< First< Prev

Page of 8

Next >Last >>

Select item 751037871.

Arfrp1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS3987, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75103787

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1141204872.

Arfrp1 - Pancreatic and duodenal homeobox 1 deficiency effect on islet β-cells

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4934, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 114120487

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 923385873.

Arfrp1 - MyD88 and TRIF deficient spleen response to septic peritonitis

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4433, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 92338587

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1268259874.

Arfrp1 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS5456, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126825987

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 874984875.

Arfrp1 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4317, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87498487

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76637526.

Arfrp1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTACTGGTGTGTGTTT (ID_REF), GDS878, BC046782

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7663752

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1064345877.

Arfrp1 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4886, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106434587

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 880864878.

Arfrp1 - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4334, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 88086487

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1013321879.

Arfrp1 - Clock mutant cecum response to Salmonella enterica serovar Typhimurium infection at different circadian times

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4622, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 25 samples

ID:: 101332187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8409218710.

Arfrp1 - Chlamydia muridarum genital tract infection model: CD4 T cells

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4355, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 84092187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11436208711.

Arfrp1 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4946, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114362087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10005848712.

Arfrp1 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4588, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100058487

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10659718713.

Arfrp1 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4893, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106597187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7314098714.

Arfrp1 - Adrenergic stress effect on transcription factor GATA4 S105A mutants: heart ventricle

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS3931, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 73140987

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11010688715.

Arfrp1 - Induced myeloproliferative neoplasm effect on Scl-tTA::TRE-BCR/ABL double-transgenic model of chronic myeloid leukemia: osteoblastic lineage cells

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS5024, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 110106887

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8472128716.

Arfrp1 - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4371, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84721287

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7939798717.

Arfrp1 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4116, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79397987

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752605218.

Arfrp1 - MPSS transcriptome analysis project

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTACTGGTGTGTGTTT (ID_REF), GDS868, BC046782

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7526052

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10262888719.

Arfrp1 - Peroxisome Proliferator-Activated Receptor γ Coactivator-1 deficiency effect on adult cardiac biventricle

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS4776, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 102628887

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11605788720.

Arfrp1 - Bcl6 deficiency effect on regulatory T cell

Annotation:: Arfrp1, ADP-ribosylation factor related protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10490672 (ID_REF), GDS5161, NM_001165991, NM_001165992, NM_001165995, NM_029702, NR_028585, BC010713, BC046782, BC046786, AK083490, chr2:181357829-181365361 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116057887

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 28386123) (158)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 158

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity