GEO Profiles Links for Nucleotide (Select 26082928) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 24

<< First< Prev

Page of 2

Next >Last >>

Select item 1303502541.

Zfhx2os - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL4134, 5254 (ID_REF), GDS5664, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130350254

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1270384542.

Zfhx2os - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL4134, 5254 (ID_REF), GDS5461, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127038454

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1222825543.

Zfhx2os - Industrial pollution effect on liver

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 5254 (ID_REF), GDS5331, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122282554

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1153029544.

Zfhx2os - Glucocorticoid effect on the female liver

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL4134, 5254 (ID_REF), GDS5036, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115302954

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1152563545.

Zfhx2os - Glucocorticoid effect on the male liver

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL4134, 5254 (ID_REF), GDS5035, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115256354

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1092151546.

Zfhx2os - Diabetic db/db heart response to rosiglitazone

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL4134, 5254 (ID_REF), GDS4990, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109215154

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 553917947.

Zfhx2os - Heart failure progression model: non-infarcted ventricular tissue

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS3386, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 55391794

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 551775548.

Zfhx2os - Iron enriched and deficient diets effect on the liver

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL4134, 5254 (ID_REF), GDS3373, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55177554

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 529515239.

Zfhx2os - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL2872, 5123 (ID_REF), GDS3259, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52951523

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 5179322310.

Zfhx2os - Interleukin-22 effect on colon cultures

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL2872, 5123 (ID_REF), GDS3226, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51793223

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 4418179411.

Zfhx2os - Diethylstilbestrol effect on the prepubertal uterus: dose response

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS2924, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 44181794

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 3187952312.

Zfhx2os - Resveratrol and high-fat high-calorie diet effect on liver

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL2872, 5123 (ID_REF), GDS2413, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, Z-score, 14 samples

ID:: 31879523

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 3031024313.

Zfhx2os - Transgenic T-cell receptor model of tolerant CD8+ T cells

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m19479_at (ID_REF), GDS2327, 6430605P16 (CLONE ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 30310243

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2797049414.

Zfhx2os - Estradiol effect on the uterus: time course

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS2208, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 27970494

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2496149415.

Zfhx2os - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS2078, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24961494

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 2493819416.

Zfhx2os - Estren effect on the uterus: time course

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS2077, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24938194

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1770149417.

Zfhx2os - Werner syndrome protein and poly(ADP-ribose) polymerase-1 null mutants

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS1675, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 17701494

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1302329418.

Zfhx2os - Conjugated linoleic acid delipidative effect on obese line: time course

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS1360, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 13023294

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1299999419.

Zfhx2os - Conjugated linoleic acid delipidative effect on obese line: time course (dye-swap)

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL891, 16094 (ID_REF), GDS1359, AK032589, A_51_P385059 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 4 samples

ID:: 12999994

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 765878120.

Zfhx2os - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Zfhx2os, zinc finger homeobox 2, opposite strand

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCTTTCCAAACCAGCT (ID_REF), GDS878, AK032589

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7658781

GEO DataSets Gene Chromosome neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26082928) (24)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 24

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity