GEO Profiles Links for Nucleotide (Select 239985491) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 389

<< First< Prev

Page of 20

Next >Last >>

Select item 824678881.

Foxo1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2656498 (ID_REF), GDS3720, NM_019739

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82467888

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824645072.

Foxo1 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2509340 (ID_REF), GDS3720, NM_019739

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82464507

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 847815433.

Foxo1 - Activated Autoimmune Regulator (AIRE)-deficient, CD8+CD28low regulatory T lymphocytes

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS4373, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 84781543

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74669804.

Foxo1 - MPSS transcriptome analysis project

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGTGTGAATCATGG (ID_REF), GDS868, NM_019739

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7466980

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1125127905.

Foxo1 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL4783, M200006713 (ID_REF), GDS2645, NM_019739, AF126056

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112512790

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751039436.

Foxo1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS3987, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75103943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1322285347.

Foxo1 - High-fat diet effect on brown adipose tissue development

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2656498 (ID_REF), GDS6000, NM_019739, FOXO1 (ORF)

DataSet type:: Expression profiling by array, transformed count, 33 samples

ID:: 132228534

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969722438.

Foxo1 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS4490, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96972243

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 989618439.

Foxo1 - Akt transgenic response to lymphocytic choriomeningitis virus (LCMV) infection: CD8 T cell types

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS4554, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 5 samples

ID:: 98961843

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10005864310.

Foxo1 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS4588, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100058643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6679334311.

Foxo1 - Skin-derived precursors

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS3753, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 66793343

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12705153112.

Foxo1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL4134, 18331 (ID_REF), GDS5461, NM_019739, A_51_P138044 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127051531

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036333113.

Foxo1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL4134, 18331 (ID_REF), GDS5664, NM_019739, A_51_P138044 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130363331

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11531603114.

Foxo1 - Glucocorticoid effect on the female liver

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL4134, 18331 (ID_REF), GDS5036, NM_019739, A_51_P138044 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115316031

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13202574315.

Foxo1 - Nebulin deficiency effect on the quadriceps

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS5880, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132025743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13038235616.

Foxo1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL4134, 37356 (ID_REF), GDS5664, NM_019739, A_52_P453884 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130382356

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11533505617.

Foxo1 - Glucocorticoid effect on the female liver

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL4134, 37356 (ID_REF), GDS5036, NM_019739, A_52_P453884 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115335056

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10175774318.

Foxo1 - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL6246, 10491962 (ID_REF), GDS4755, NM_019739, AF114258, AF126056, chr3:52268374-52349538 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 101757743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12707055619.

Foxo1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL4134, 37356 (ID_REF), GDS5461, NM_019739, A_52_P453884 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127070556

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6403242120.

Foxo1 - SIRT1 deficiency effect on the liver

Annotation:: Foxo1, forkhead box O1

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P138044 (ID_REF), GDS3666, NM_019739, A_51_P138044 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64032421

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 20

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 239985491) (389)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 389

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity