GEO Profiles Links for Nucleotide (Select 18044063) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 152

<< First< Prev

Page of 8

Next >Last >>

Select item 75337111.

Gpn1 - MPSS transcriptome analysis project

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTGCTCACACGAGGT (ID_REF), GDS868, BC020174

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533711

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 44522622.

Snx17 - Preimplantation development

Annotation:: Snx17, sorting nexin 17 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 6462 (ID_REF), GDS578, BC020174, BC064761, CL213214, BC029675, H3025E05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4452262

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1294214813.

Gpn1 - Basic helix-loop-helix transcription factor Bhlhe40-deficient differentiated T helper cell subsets in vitro

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS5636, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 129421481

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753845814.

Gpn1 - Developing testis and ovary

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS3995, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75384581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 840954815.

Gpn1 - Chlamydia muridarum genital tract infection model: CD4 T cells

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4355, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 84095481

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1047000816.

Gpn1 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4827, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104700081

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 826870817.

Gpn1 - Pluripotent embryonic stem cells and multipotent adult germline stem cells in 129SV and Stra8-EGFP/Rosa26-LacZ strains

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4170, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 82687081

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1155322818.

Gpn1 - Transciption factor Meis1 deficiency effect on lineage-negative bone marrow cells

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS5095, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 115532281

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 846413819.

Gpn1 - Normal colonic lamina propria macrophage and dendritic cell populations

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4369, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 84641381

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10176088110.

Gpn1 - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4755, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 101760881

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 767141111.

Gpn1 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTGCTCACACGAGGT (ID_REF), GDS878, BC020174

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7671411

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13041038112.

Gpn1 - Pathogen-associated molecular-pattern curdlan effect on interleukin-2 deficient GM-CSF myeloid dendritic cells

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS5665, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 130410381

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12191428113.

Gpn1 - Embryonic fibroblast response to ectopic expression of transcription factors Oct4, Sox2, Klf4, c-Myc: time course

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS5316, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 121914281

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 614276214.

Snx17 - Blastocyst dormancy and activation comparison

Annotation:: Snx17, sorting nexin 17 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 6462 (ID_REF), GDS752, BC020174, BC064761, CL213214, BC029675, H3025E05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6142762

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12682928115.

Gpn1 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS5456, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126829281

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8750178116.

Gpn1 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4317, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87501781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11614858117.

Gpn1 - In vitro-differentiated CD4+ T helper cell subsets

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS5166, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 116148581

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8361278118.

Gpn1 - Transcription factor MIST1-null and MIST1-induced pancreas

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4341, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 83612781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10784998119.

Gpn1 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4944, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107849981

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10810028120.

Gpn1 - Prostate cancer cell line response to overexpression of Twist1 and Twist1 mutants

Annotation:: Gpn1, GPN-loop GTPase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10520800 (ID_REF), GDS4955, NM_133756, XM_006504162, BC020174, BC096466, chr5:31494761-31511627 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 108100281

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 18044063) (152)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 152

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity