GEO Profile Links for Gene (Select 81500) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 569389851.

Sil1 - Vancomycin effect on the kidney: dose response

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS3435, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56938985

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61395862.

Sil1 - Blastocyst dormancy and activation comparison

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae) (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 3286 (ID_REF), GDS752, AF058318, AK085499, BC028488, C0630B03-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6139586

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 370022853.

Sil1 - Asthma model: lungs

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS2647, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 37002285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 129826134.

Sil1 - Muscle response to low frequency electrical stimulation: time course

Annotation:: Sil1, Endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1345, 13013 (ID_REF), GDS1357, AA838920

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 12982613

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 640461075.

Sil1 - SIRT1 deficiency effect on the liver

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P438200 (ID_REF), GDS3666, NM_030749, A_51_P438200 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64046107

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152725736.

Sil1 - Glucocorticoid effect on the male liver

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 21473 (ID_REF), GDS5035, NM_030749, A_51_P438200 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115272573

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 765886857.

Sil1 - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS4034, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76588685

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153191738.

Sil1 - Glucocorticoid effect on the female liver

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 21473 (ID_REF), GDS5036, NM_030749, A_51_P438200 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115319173

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1291354079.

Sil1 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P438200 (ID_REF), GDS5629, NM_030749, A_51_P438200 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129135407

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9227828510.

Sil1 - Rough attenuated Brucella suis strain infection effect on macrophage cell line: time course

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS4432, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, count, 42 samples

ID:: 92278285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10220868511.

Sil1 - Pancreatic cancer model: saliva supernatant

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS4767, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 102208685

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5948418512.

Sil1 - Plasmacytoid dendritic cell response to transcription factor E2-2

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS3519, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 59484185

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6434534513.

Sil1 - Hypertension model: aorta

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL9734, 100095191_TGI_at (ID_REF), GDS3672, NM_030749

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64345345

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5519377314.

Sil1 - Iron enriched and deficient diets effect on the liver

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 21473 (ID_REF), GDS3373, NM_030749, A_51_P438200 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55193773

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7916528515.

Sil1 - Prostate response to activated form of p110β isoform of PI3-kinase

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL8321, 1417354_at (ID_REF), GDS4108, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 79165285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5366448516.

Sil1 - CTCF depletion effect in oocytes

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS3294, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 53664485

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752988417.

Sil1 - MPSS transcriptome analysis project

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCTACCGTCAGGACCT (ID_REF), GDS868, BC016119

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7529884

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1809588518.

Sil1 - Self-renewing memory B cell

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS1695, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 18095885

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12229877319.

Sil1 - Industrial pollution effect on liver

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 21473 (ID_REF), GDS5331, NM_030749, A_51_P438200 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122298773

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12406368520.

Sil1 - Sodium tungstate effect on insulin receptor substrate 2 knockout mice: pancreatic islets

Annotation:: Sil1, endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1261, 1417354_at (ID_REF), GDS5380, 81500 (Gene ID), NM_030749

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124063685

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 81500) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity