GEO Profile Links for Gene (Select 69540) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 258547121.

Klk10 - Developing mammary gland: terminal end buds and ducts

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL2660, 3712 (ID_REF), GDS2115, BC002100

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 25854712

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 546166642.

Klk10 - Skin carcinogenesis model

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL4234, 4540050 (ID_REF), GDS3334, NM_133712

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54616664

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 232504843.

Klk10 - Airway disease trait manifestation in various genetic backgrounds: lungs (MG-U74C)

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL83, 167242_at (ID_REF), GDS1988, 69540 (Gene ID), AV083009

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23250484

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 429101294.

Klk10 - Folate deficiency and arsenic effect on the skin

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1460236_at (ID_REF), GDS2872, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 42910129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 777192625.

Klk10 - Keratin 6a+, K6-tva RCAS-PyMT transgenic model of breast cancer

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL8321, 1460236_at (ID_REF), GDS4064, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 77719262

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299247966.

Klk10 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1243407 (ID_REF), GDS5651, NM_133712, KLK10 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129924796

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74834337.

Klk10 - MPSS transcriptome analysis project

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGAAGAGTCATTCGTT (ID_REF), GDS868, NM_133712

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7483433

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 262690628.

Klk10 - UV irradiation effect on skin inactivated for tyrosine kinase receptor ErbB2: time course

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL339, 1460236_at (ID_REF), GDS2139, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, transformed count, 23 samples

ID:: 26269062

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 571972849.

Klk10 - Embryonic stem cell response to STAT3 overexpression in vitro (MG-U74C)

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL83, 167242_at (ID_REF), GDS3446, 69540 (Gene ID), AV083009

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57197284

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8904542910.

Klk10 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1460236_at (ID_REF), GDS4408, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89045429

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12240512911.

Klk10 - p38-alpha deficient keratinocyte response to ultraviolet-B in vitro

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1460236_at (ID_REF), GDS5335, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 122405129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10905493712.

Klk10 - Phorbol ester effect on skin of Rho exchange factor Vav2/Vav3 double knockout mutants: time course

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL6246, 10552488 (ID_REF), GDS4985, NM_133712, BC002100, chr7:43781067-43785410 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 109054937

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 463030713.

Klk10 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m06043_a_at (ID_REF), GDS592, 2300002A13 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4630307

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4155412914.

Klk10 - Cannabinoid receptor double knockout mutant response to contact allergen

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1460236_at (ID_REF), GDS2820, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41554129

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3883086215.

Klk10 - Pubertal mammary gland development

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL339, 1460236_at (ID_REF), GDS2721, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38830862

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4105792916.

Klk10 - Dexamethasone effect on fetal chondrocytes in vitro: time course

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1460236_at (ID_REF), GDS2802, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41057929

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7234972917.

Klk10 - Oral mucosal adaptive immune model: time course

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1460236_at (ID_REF), GDS3909, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 72349729

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 126738418.

Klk10 - Hyperoxic lung injury (U74Cv2)

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL83, 167242_at (ID_REF), GDS249, 69540 (Gene ID), AV083009

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 1267384

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11876262919.

Klk10 - Skin response to injury: time course

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL1261, 1460236_at (ID_REF), GDS5239, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 118762629

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8414876220.

Klk10 - Host response to uninfected Ixodes scapularis nymphal tick attachment: time course

Annotation:: Klk10, kallikrein related-peptidase 10

Organism:: Mus musculus

Reporter:: GPL8321, 1460236_at (ID_REF), GDS4357, 69540 (Gene ID), NM_133712

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 84148762

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 69540) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity