GEO Profile Links for Gene (Select 432982) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 223

<< First< Prev

Page of 12

Next >Last >>

Select item 353344241.

Slc11a2 - Bone morphogenic protein 6 effect on an endothelial cell line: time course

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL922, 12224 (ID_REF), GDS2571, H3029B01 (CLONE ID), A_65_P17915 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 35334424

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 32282012.

Slc11a2 - Malaria resistance

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL519, 2701 (ID_REF), GDS471, AW537100

DataSet type:: Expression profiling by array, log ratio, 14 samples

ID:: 3228201

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75330283.

Slc11a2 - MPSS transcriptome analysis project

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGCCAGGTCGGCAGC (ID_REF), GDS868, AA217379

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533028

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 945378734.

Slc11a2 - Tuberous sclerosis complex 1 deficient naïve CD4 and CD8 T cells

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL11180, 1452078_PM_a_at (ID_REF), GDS4572, BG065264

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 94537873

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 79008885.

Slc11a2 - Aquaporin-1 knockout kidney inner medulla profile (II)

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL1104, H3029B01 (ID_REF), GDS900, BG065264

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 7900888

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644627776.

Slc11a2 - Hypertension model: kidney

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL9734, 100112703_TGI_at (ID_REF), GDS3675, BU519940

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64462777

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 223380247.

Slc11a2 - Growth hormone effect on bone: time course

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL922, 12224 (ID_REF), GDS1929, H3029B01 (CLONE ID), A_65_P17915 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 22338024

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 156025248.

Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Transcribed locus (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL2727, 15493 (ID_REF), GDS1527, BG071291, BG084160, H3097B03 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15602524

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644231779.

Slc11a2 - Hypertension model: liver

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL9734, 100112703_TGI_at (ID_REF), GDS3674, BU519940

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64423177

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7564384210.

Slc11a2 - High and Low Anxiety: multiple brain regions

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL7467, 23092 (ID_REF), GDS4001, AI852578

DataSet type:: Expression profiling by array, log2 ratio, 70 samples

ID:: 75643842

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3022882411.

Slc11a2 - Vascular endothelial cell differentiation in vitro

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL922, 12224 (ID_REF), GDS2322, H3029B01 (CLONE ID), A_65_P17915 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 24 samples

ID:: 30228824

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4175922712.

Slc11a2 - Sickle cell anemia model: brain response to naloxone

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL4464, 84e6 (ID_REF), GDS2826, AI850522

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 41759227

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11664054713.

Slc11a2 - Adaptor protein ASC deficiency effect on bone marrow dendritic cells

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL11180, 1426441_PM_at (ID_REF), GDS5183, BG065264

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 116640547

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9785617714.

Slc11a2 - Atherosclerosis susceptibility model: macrophages

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL9734, 100112703_TGI_at (ID_REF), GDS4527, BU519940

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97856177

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2039255915.

Slc11a2 - Surgical model of acute lymphedema induction

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL3506, 957 (ID_REF), GDS1810, BG065264, H3029B01 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 9 samples

ID:: 20392559

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 839426716.

Slc11a2 - Lacrimal gland and cornea burn: time course (SMCmou6600Av1)

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL1231, 4667 (ID_REF), GDS948, BG084160

DataSet type:: Expression profiling by array, log ratio, 18 samples

ID:: 8394267

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10469005817.

Gm5475 - Tropomodulin3 deficiency effect on the fetal liver

Annotation:: Gm5475, predicted gene 5475

Organism:: Mus musculus

Reporter:: GPL6246, 10426905 (ID_REF), GDS4827, NR_040351, AK142522, chr15:100423193-100428150 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 104690058

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9239617318.

Slc11a2 - Tuberous sclerosis complex 1 deficient CD4 T cell response to T cell receptor stimulation

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL11180, 1452078_PM_a_at (ID_REF), GDS4434, BG065264

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 92396173

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11095877319.

Slc11a2 - Diabetes and Obesity Regulated gene gain-of-function effect on skeletal muscle

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL11180, 1452078_PM_a_at (ID_REF), GDS5054, BG065264

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 110958773

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4175979320.

Slc11a2 - Sickle cell anemia model: brain response to naloxone

Annotation:: Slc11a2, Solute carrier family 11 (proton-coupled divalent metal ion transporters), m...

Organism:: Mus musculus

Reporter:: GPL4464, 90e1 (ID_REF), GDS2826, AI852578

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 41759793

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 12

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 432982) (223)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 223

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity