|
Status |
Public on Feb 15, 2012 |
Title |
76_AAA_RAQWF |
Sample type |
SRA |
|
|
Source name |
synthetic library--Z10 library
|
Organism |
synthetic construct |
Characteristics |
library: Z10 library library selection: bacterial one-hybrid (B1H) selected
|
Growth protocol |
For each selection using the HD library at least 1x108 dual transformants (of HD expression vector and binding site reporter vector into the selection strain) were plated on NM media supplemented with 1uM IPTG and 200uM uracil. The stringency of each selection was adjusted such that 1000-2000 colonies were recovered. For each selection using the ZF10 libaray selections was performed that all selections were plated on NM media supplemented with 5mM 3-AT, 1uM IPTG, and 200uM uracil.
|
Extracted molecule |
other |
Extraction protocol |
For HD library-- Surviving colonies from each selection were pooled and prepared for sequencing). HD clones were amplified using a forward primer (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTATGCTTGCCCTGTCGAGTCC) and reverse primer (CTTAATGCGCCGCTACAGGGC), where the forward primer incorporated the Illumina P2-adapter sequence. Each PCR product was then digested with either BamHI or XbaI for the ligation of barcoded P1 adapters prior to Illumina library generation and sequencing. Recovered ZF10 library members were identified via Illumina sequencing, the initial PCR product was digested with either BamHI or NcoI for the ligation of barcoded P1 adaptors (Table S1 & S5).
|
|
|
Library strategy |
OTHER |
Library source |
other |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
selected from the bacterial-one hybrid system molecule: plasmid DNA
|
Data processing |
Each fasta line represents a unique sequence identified where the HD interacts with that DNA sequence.
|
|
|
Submission date |
Feb 14, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Scot Wolfe |
E-mail(s) |
[email protected]
|
Organization name |
UMass Medical School
|
Department |
MCCB
|
Street address |
364 Plantation Street, LRB 619
|
City |
Worcester |
State/province |
MA |
ZIP/Postal code |
01605 |
Country |
USA |
|
|
Platform ID |
GPL15228 |
Series (1) |
GSE35806 |
Exploring the DNA-Recognition Potential of Homeodomains |
|
Relations |
SRA |
SRX119874 |
BioSample |
SAMN00789015 |