GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM8485738

Query DataSets for GSM8485738

Status

Public on Aug 31, 2024

Title

Age-matched Xenopus embryo, stage 35, sample 1

Sample type

SRA

Source name

whole embryo

Organism

Xenopus laevis

Characteristics

tissue: whole embryo
genotype: WT
treatment: none

Growth protocol

Xenopus laevis embryos were fertilized in vitro according to standard protocols in 0.1X Marc's Modified Ringer's (MMR) solution and kept at 14oC. At stage 9 a subset of embryos were transferred to 0.75X MMR solution and the ectodermal animal cap tissue was cut out of the embryos. This tissue was allowed to heal and develop in 0.75X MMR at 14oC into autonomously-moving Xenobots by day 7. Intact sibling embryos kept in 14oC for 7 days (reaching stage 35) were used as age-matched embryos.

Extracted molecule

total RNA

Extraction protocol

A sample of Xenobot consisted of 50 pooled Xenobots and each was repeated 3 times. A sample of age-matched Xenopus embryos consisted of 10 pooled stage 35 Xenopus embryos and each was repeated 3 times. Tissue was extracted using TRI Reagent (Molecular Research Center, Inc - MRC) as per the manufacturer’s protocol, and total RNA quality and quantity was assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific).
RNA library preparation was done with the Illumina Stranded Total RNA with Ribo-Zero Plus. Libraries were then multiplexed, and an rRNA depletion run using single-end, 75-nucleotide sequencing was performed on NextSeq 550 High Output 75 cycles.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

NextSeq 550

Description

rsem_gene_count.tsv
sv_adj_logCPM_for_plotting.tsv
06_Emb

Data processing

Trim adapter and polyX tails: The RNAseq raw reads are single-end reads. The reads were trimmed for adapter “CTGTCTCTTATACACATCTCCGAGCCCACGAGAC” and polyX tails, then filtered by sequencing Phred quality (>= Q15) using fastp (Chen et al., 2018).
Generating genome indexes: Xenopus laevis genome sequences and gene annotation were downloaded from the NCBI genome database, version 10.1. GenomeGenerate module of the STAR aligner (Dobin et al., 2013) was used to generate the genome indexes. STAR aligner option was set to sjdbOverhang = 75 for 76-bp reads, as was ideal.
Aligning reads to the genome: Adapter-trimmed reads were aligned to the genome using STAR aligner with the two-pass option. Reads were mapped across the genome to identify novel splice junctions in the first-pass. These new annotations were then incorporated into the reference indexes and reads were re-aligned with this new reference in the second pass. While more time-intensive, this step could aid in aligning across these junctions, especially in organisms where the transcriptome was not as well annotated. The resulting gene count table is at rsem_gene_count.tsv
Estimate expression: Gene expression was estimated from the gene alignments using RSEM tool for accurate quantification of gene and isoform expression from RNA-Seq data (Li and Dewey, 2011).The resulting gene count table is at rsem_gene_count.tsv
Filtering, normalization, and transformation: To filter out low expressing genes, we kept genes that had counts per million (CPM) more than 0.6 in at least 3 samples. There were 28009 genes after filtering. We then normalized counts by weighted trimmed mean of M-values (TMM) (Robinson and Oshlack 2010). If no normalization is needed, all the normalization factors would be 1. Here the normalization factors were between 0.78 and 1.28. To use linear models in the following analysis, we performed Voom transformation (Law et al. 2014) to transform counts into logCPM.
Differential expression analysis: To discover the differential genes, we uselimma, an R package that powers differential expression analyses(Ritchie et al. 2015). We performed moderated t-tests to detect genes that were differentially expressed
Assembly: Xenopus laevis (NCBI genome database, version 10.1)
Supplementary files format and content: tab-delimited file includes a gene count table
Supplementary files format and content: tab-delimited file includes logCPM normalized values

Submission date

Aug 27, 2024

Last update date

Aug 31, 2024

Contact name

Vaibhav P Pai

E-mail(s)

[email protected]

Organization name

Tufts University

Department

Biology