|
| Status |
Public on Apr 01, 2024 |
| Title |
Arabidopsis thaliana 6d seedling sRNA-seq r1 |
| Sample type |
SRA |
| |
|
| Source name |
6d seedling
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: 6d seedling
molecule type: short RNAs (20-65nt)
treatment: none
|
| Growth protocol |
For A. thaliana seedlings, seeds were sterilized using vapor-phase sterilization (seeds were exposed to 100 mL bleach + 3 mL concentrated HCl in a vacuum chamber for 3 hours), then approximately 20-40 seeds per plate were sown on 1x MS plates and stratified for 3 days at 4°C in the dark. Plates were transferred to growth room and grown for 6 days in long-day conditions (16 h light, 8 h dark). After 6 days, seedlings from each plate were harvested into Eppendorf tubes containing a metal ball bearing and immediately flash frozen in liquid nitrogen. Physcomitrium (Physcomitrella) patens (Gransden) was grown on plates with BCDA medium in a growth cabinet at 21°C under 16h light.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
A. thaliana seedlings tissue was ground using the Qiagen TissueLyser II, at 1/30s frequency for 1.5 min twice. RNA was purified using the Zymo Direct-zol RNA MiniPrep kit.
csRNA-seq was performed as described in (S. H. Duttke et al. 2019). Small RNAs of ~20-60 nt were size selected from 0.4-3 µg of total RNA by denaturing gel electrophoresis. A 10% input sample was taken aside and the remainder enriched for 5’-capped RNAs. Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5´-Phosphate-Dependent Exonuclease (Lucigen). Subsequently, RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark. Input (sRNA) and csRNA-seq libraries were prepared as described in (Hetzel et al. 2016) using RppH (NEB) and the NEBNext Small RNA Library Prep kit, amplified for 11-14 cycles. Total RNA-Seq Library Preparation Strand-specific, paired-end libraries were prepared from total RNA by ribosomal depletion using the Ribo-Zero Gold plant rRNA removal kit (Illumina, San Diego, CA). Samples were processed following the manufacturer’s instructions.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
sRNA-seq; small RNA mapping in A.thaliana cells; Experiment MS343
A.thaliana-6dseedling-10.tss.txt
|
| Data processing |
csRNA-seq (small capped RNAs, ~20-60 nt) and sRNA-seq reads (“input”) were trimmed of their adapter sequences using HOMER (“homerTools trim -3 AGATCGGAAGAGCACACGTCT -mis 2 -minMatchLength 4 -min 20" none -f {csRNA_fastq_path}/*fastq.gz”)(Heinz et al. 2010). Reads were aligned to the appropriate genome using Hisat2 version 2.2.1 (Kim et. al. 2019) with parameters “hisat2 -p 30 --rna-strandness RF --dta -x {hisat2_genome_index} -U {path_rimmed_csRNA or sRNA} -S {output_sam} 2> {mapping_stats}”. Hisat2 indices were then created for each genome used ("hisat2-build -p 40 genome.dna.toplevel.fa {Hisat2_indexfolder}") with exception for barely which required the addition of "--large-index" due to genome size. Tag directory folders were then created using HOMER makeTagDirectories ("makeTagDirectories {outputName} -omitSN -checkGC -fragLength 150 -single")(Heinz et. al. 2010). Only reads with a single, unique alignment (MAPQ >=10) were considered in the downstream analysis. This consolidates the aligned read information into a read/chromosome format along with other important alignment information. Peaks were called and annotated using HOMER ("findcsRNATSS.pl {csRNA} -o {output} -i {sRNA} -genome hg38 -size 150 -ntagThreshold 10") (Duttke et al. 2019) and annotatePeaks.pl ("annotatePeaks.pl {tss/tsr.txt} hg38 -strand + -fragLength 1 -rlog -d {listOfTagDirs} > {output}") (Heinz et. al. 2010) respectively (additional details available in the manuscript).
Transcription start sites (TSSs) and Transcription start regions (TSRs) were determined in this study. TSRs were called using findcsRNATSS.pl (detailed above) while TSSs were called using getTSSfromReads.pl ("getTSSfromReads.pl -d {csRNA_tagdir} -dinput {sRNA_tagdir} -min 7 > {output_file}") (Heinz et. al. 2010). To ensure high quality TSSs, at least 7 per 10^7 aligned reads were required and TSS were required to be within called TSR regions.
Paired end total ribosomal RNA-depeleted RNA-seq libraries were trimmed using skewer (“time -p skewer -m mp {read1} {read2} -t 40 -o {trimmed_fastq_output}”) (Jiang et al. 2014) and aligned using Hisat2 (Kim et al. 2019) to ensure all data were processed as similar as possible (“hisat2 -p 30 --rna-strandness RF --dta -x {hisat2_index} -1 {trimmed_RNAseq_R1} -2 {trimmed_RNAseq_R2} -S {output_sam} 2> {mapping_file}”). In this manuscript, total RNA-seq was exclusively used to determine RNA-stability as described in the csRNA-seq analysis.
5’GRO-seq peaks were called using HOMER’s “findPeaks {5GRO_tagdirectory} -i {GRO_tagdirectory} -style tss -F 3 -P 1 -L 2 -LP 1 -size 150 -minDist 200 -ntagThreshold 10 > 5GRO_TSRs.txt”. Detailed explanation of each parameter can be found at http://homer.ucsd.edu/homer/ngs/tss/index.html.
Assembly: TAIR10, Phypa V3
Supplementary files format and content: bed files: Locations indicate TSS positions. TSS.txt files: text files containing tab delimited information about found transcription start site culsters (TSRs). Motif file containing new line delimited motifs. Motif files: files containing motifs used with a ‘>’ indicating motif information followed by rows with nucleotide probability.
|
| |
|
| Submission date |
Mar 29, 2024 |
| Last update date |
Apr 01, 2024 |
| Contact name |
Sascha Duttke |
| Organization name |
Washington State University
|
| Department |
School of Molecular Biosciences
|
| Lab |
Dr. Duttke Lab
|
| Street address |
BLS 202, 100 Dairy Road
|
| City |
Pullman |
| State/province |
Washington |
| ZIP/Postal code |
99163 |
| Country |
USA |
| |
|
| Platform ID |
GPL30821 |
| Series (1) |
| GSE233927 |
Comparative analysis of nascent transcription among plant species |
|
| Relations |
| BioSample |
SAMN40654267 |
| SRA |
SRX24098599 |
