|
| Status |
Public on Jan 29, 2024 |
| Title |
NFKBIE_vitro_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
NFKBIE-ko TCL1-355 TKO cells
|
| Organism |
Mus musculus |
| Characteristics |
tissue: blood
cell line: TCL1-355 TKO
cell type: leukemia cell line
treatment: Targeted exon 2 of the NFKBIE gene by nucleofection-mediated delivery of a ribonucleoprotein complex containing recombinant Cas9 and a NFKBIE guide RNA
|
| Treatment protocol |
A predesigned IDT cr-RNA (AGTGATTCACGAAGCCCCGT) was used for targeting the NFKBIE gene. To generate the Cas9 ribonucleoprotein (RNP) complexes, the cr-RNA (1.5 mM) was combined with 1.5 mM ATTO 550-labeled trans-activating cr-RNA, 0.75 mM recombinant Cas9 protein, and 1.5 mM Alt-R Cas9 electroporation enhancer in 5 mL of nuclease-free duplex buffer (IDT). The Cas9 RNP complex was then electroporated using the Amaxa Nucleofector II device and the Z-001 program into 6x106 leukemic cells resuspended in 100ml Mouse B cell Nucleofector solution (Lonza).
|
| Growth protocol |
Cells were thawed and cultured in RPMI-1640 supplemented with 10% heat-inactivated FBS, 100U/mL penicillin, 0.1mg/mL streptomycin, 2mM L-glutamine, and 1mM sodium pyruvate (Invitrogen) at a concentration of 0.5x106 per mL for 20 hours prior to CRISPR/Cas9 editing with the Alt-R system.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted with RNeasy Micro Kit (Quiagen) following manufacturer recommendations.
The RNA-seq libraries were prepared according to the standard Illumina protocol with the mRNA-seq Illumina TruSeq. cDNA libraries were checked for quality and quantified using the DNA-1000 kit (Agilent) on a 2100 Bioanalyzer.
RNA-Seq on a Illumina NovaSeq 6000 instrument, using a 150-bp, dual-indexed, paired-end sequencing configuration
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
NFKBIE-wt TCL1-355 TKO cells Targeted exon 2 of the NFKBIE gene by nucleofection-mediated delivery of a ribonucleoprotein complex containing recombinant Cas9 and a NFKBIE guide RNA Retrieved from in vitro colture
|
| Data processing |
Basecalls performed using CASAVA (Illumina Inc.)
Transcript quantification was conducted with Salmon (v1.8) mapped to the Mus musculus genome version GRCm39 and with reference gtf annotation version 103.
Read counts generated by Salmon were analysed by using DESeq2 package (Love, 2014) for detecting transcripts that were differentially expressed. An adjusted p-value cut off of 0.05 was decided as threshold for detection of DEGs.
Assembly: Mus musculus genome version GRCm39 and with reference annotation gtf version 103.
Supplementary files format and content: Tab-delimited text files include COUNTS values for each Sample
|
| |
|
| Submission date |
May 05, 2023 |
| Last update date |
Jan 29, 2024 |
| Contact name |
Silvano Piazza |
| E-mail(s) |
[email protected]
|
| Organization name |
ICGEB
|
| Lab |
Computational Biology
|
| Street address |
localita' Padriciano 99
|
| City |
Trieste |
| ZIP/Postal code |
34149 |
| Country |
Italy |
| |
|
| Platform ID |
GPL24247 |
| Series (1) |
| GSE231799 |
NFKBIE-mutated CLL cells reshape the immune microenvironment and display selective resistance to BTK inhibitor treatment |
|
| Relations |
| BioSample |
SAMN34719757 |
| SRA |
SRX20236885 |
