 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 03, 2024 |
| Title |
Arabidopsis, +ORF1, +ORF2, -Cas9, replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
7 day old seedlings
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: 7 day old seedlings
genotype: Wt + specific transgenes
cultivar: Columbia
|
| Treatment protocol |
Arabidopsis thaliana: Various binary vectors were introduced into Agrobacterium tumefaciens GV3101. All transgenic lines were transformed using the Agrobacterium-mediated floral dip method and subsequent selection for Hygromycin-resistant plants. Glycine max: Various binary vectors were introduced into Agrobacterium tumefaciens AGL1. Mature half-seeds of Soybean (Glycine max var. Williams 82) were transformed to generate transgenic plants using a modified version of the method adapted from a previous publication (PMID: 25300848). Transgenic plants were selected for Basta-resistance and confirmed by PCR.
|
| Growth protocol |
Arabidopsis thaliana: All plants were grown at 22℃ under 16-hour day conditions in a MTPS-120 growth chamber with 200 µmol m−2 s−1 light intensity. Glycine max: Plants are grown in the chamber under the following conditions. Temperature: 25°C day/ 23°C night (77°F/73°F); Humidity: 50%; Light: 14-hour day at 200-600 μmol. Regenerated transgenic plants were then transplanted into a greenhouse to mature with following conditions. Temperature: 25°C day/ 23°C night (77°F/73°F); Humidity: 35% minimum; Light: The supplemental lights come on when the sunlight is below 400 W/m²between 6am-8pm (14 hours) from September through May and between 6-10am May through September; Shading: The shade curtain automatically closes to 50% when the sunlight level is over 900 W/m² and it pulls to 100% when the sunlight is over 1000 W/m².
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
High molecular weight DNA was isolated from fresh Arabidopsis seedlings and Soybean leaf tissue using the NucleoBond HMW DNA kit (Takara), and digested by restriction enzymes XbaⅠ and AluⅠ.
Fragmented DNAs ranging from ~450bp to ~2kb were purified from agarose gels, A-tailed by Klenow Fragment (3’-5’ exo-; NEB), and ligated to the pGEM T- Easy vector (Promega). 1 µL of this ligation product was used as a template for primary PCR, followed by secondary PCR using nested primers. mPing specific primers were used with the pGEM T- Easy vector primers for primary and secondary PCRs. Barcoded sequencing adapters were added to the amplicons through their inclusion in the PCR primers. The sequencing library for soybean was constructed similarly, except that the genomic DNA was isolated from leaf tissue and digested by XbaⅠ, PmlⅠ, and AluⅠ.
After passing quality controls, libraries were run on a MiSeq (Illumina) with V2 output (1X300)
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
To identify and characterize reads that have both mPing and other regions of the genome, the 3’ adapter was trimmed from raw reads using cutadapt (parameters: -a "ATCACTAGTGAATTCGCGGCC;min_overlap=10;e=0.1" -q 10). Next, only reads containing mPing sequence were identified and the matching mPing sequence was trimmed from the 5’ end using cutadapt (parameters: -g "EXPECTEDMPINGSEQUENCE;min_overlap=35;e=0.1" -q 10).
To remove reads that show mPing at its donor location, these 5’ and 3’ trimmed sequences were mapped to the reference mPing donor sequence using default parameters of bowtie2 with the additional parameter to store donor-unmapped reads (--un). These donor-unmapped reads were then mapped to the genome using default parameters of bowtie2. The start position of each mapping read was collected as the mPing insertion site into the genome.
Assembly: TAIR10 for Arabidopsis and Williams 82 reference genome (Wm82.a4.v1) from Phytozome for soybean.
Supplementary files format and content: A tab-delimited file showing the start site of each read supporting a genomic insertion site is supplied as a processed file. The four columns are chromosome, start site, strand, and sequence of the read.
Library strategy: DNA-seq
|
| |
|
| Submission date |
Mar 10, 2023 |
| Last update date |
May 03, 2024 |
| Contact name |
R. Keith Slotkin |
| E-mail(s) |
[email protected]
|
| Organization name |
Donald Danforth Plant Science Center
|
| Street address |
975 North Warson Road
|
| City |
St. Louis |
| State/province |
Missouri |
| ZIP/Postal code |
63132 |
| Country |
USA |
| |
|
| Platform ID |
GPL17970 |
| Series (2) |
| GSE227104 |
Targeted site integration in plants using a transposon system [insertion-seq] |
| GSE227105 |
Targeted site integration in plants using a transposon system |
|
| Relations |
| BioSample |
SAMN33714551 |
| SRA |
SRX19634456 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7091735_At_noCas9_Rep2_processed.tsv.gz |
8.8 Mb |
(ftp)(http) |
TSV |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
