 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 25, 2023 |
| Title |
SG_oregon_wt-3 |
| Sample type |
SRA |
| |
|
| Source name |
salivary glands
|
| Organism |
Drosophila melanogaster |
| Characteristics |
genotype: OregonR
developmental stage: L3
|
| Growth protocol |
The flies were kept at 25°C
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Total RNA from 25 salivary glands or 25 pairs of wing imaginal discs was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's protocol.
To construct RNA-seq libraries, we used NEBNext Ultra II RNA Library Prep Kit for Illumina with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). 1000 ng of RNA was used as a starting material. For imaginal discs, we followed the manufacturer's protocol, but for salivary glands it was modified, because the standard protocol did not allow for complete removal of the ribosomal RNA. To address this issue, mRNA enrichment procedure using oligo-dT beads was repeated twice. Specifically, following the first round of enrichment, mRNA was eluted in 50 ul of TE buffer preheated to 80°С and incubated with beads for 2 minutes (rather than eluted into the First Strand Synthesis Reaction Buffer as in the manufacturer’s protocol). The eluate was used for the second round of enrichment on oligo dT beads and processed as described in the protocol. Constructed RNA-seq libraries were sequenced with DNBSeq-G400 platform using 2x150bp paired-end mode (BGI, China). Three technical replicates were run.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
DNBSEQ-G400 |
| |
|
| Description |
SG RNA-seq control
|
| Data processing |
RNA-seq raw data were trimmed using Cutadapt with -u 15 -U 15 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT parameters. Then processed reads were aligned to BDGP6 (Ensembl 95) using HISAT2 aligner in paired-end mode with "no-discordant" parameter. Reads aligned to genomic locations were counted gene-wise according Ensemle annotation (https://hgdownload.soe.ucsc.edu/goldenPath/dm6/bigZips/genes/dm6.ensGene.gtf.gz) using FeatureCounts tool with -p -P -d 50 -D 1000 -B -s 2 parameters. Expression of mobile elements for each sample were calculated using SalmonTE with standart parameters.
Assembly: BDGP R6/dm5
Supplementary files format and content: Read counts per gene
|
| |
|
| Submission date |
Jan 24, 2023 |
| Last update date |
Dec 25, 2023 |
| Contact name |
Daniil Maksimov |
| E-mail(s) |
[email protected]
|
| Organization name |
MCB NSC RAS
|
| Lab |
Genomics lab
|
| Street address |
Lavrentjeva ave., 8/2
|
| City |
Novosibirsk |
| ZIP/Postal code |
630090 |
| Country |
Russia |
| |
|
| Platform ID |
GPL32218 |
| Series (1) |
| GSE223579 |
Loss of Su(var)3-9 and SetDB1 disrupts late stages of larval development of Drosophila |
|
| Relations |
| BioSample |
SAMN32886128 |
| SRA |
SRX19147454 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6964908_SG-OR3_SalmonTE_EXPR.txt.gz |
1.1 Kb |
(ftp)(http) |
TXT |
| GSM6964908_SG-OR3_featureCounts.txt.gz |
76.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
