NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM643816 Query DataSets for GSM643816
Status Public on Jun 16, 2011
Title sr-nm
Sample type SRA
 
Source name Medicago truncatula roots
Organism Medicago truncatula
Characteristics ecotype: Jemalong A17
Growth protocol Seeds of Medicago truncatula Jemalong A17 were germinated as described in. (Branscheid et al., 2010). Seedlings were grown in a sand: expanded clay substrate (1:1) under 16h light at 25°C and fertilized, unless otherwise noted, twice a week with half strengths Hoagland solution containing 20 µM phosphate. For inoculation with Glomus intraradices, an inoculum was added to the substrate at 10% (v/v). G. intraradices (strain BB-E, provided by Agrauxine, Dijon, France) was used.
Extracted molecule total RNA
Extraction protocol Total RNA was isolated using the mirVana miRNA isolation kit (Ambion) in combination with the Plant RNA Isolation Aid (Ambion). 10 µg RNA were used for small RNA library construction using the Digital Gene Expression Small RNA Sample Prep Kit (Illumina).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer II
 
Description small RNA
processed data file: sequence counts
Data processing Removed adaptores. Sequences without adapters were discarded. 3' adapter sequence: TCGTATGCCGTCTTCTGCTTGT
 
Submission date Dec 21, 2010
Last update date May 15, 2019
Contact name Patrick May
E-mail(s) [email protected]
Organization name University of Luxembourg
Department Luxembourg Centre for Systems Biomedicine
Lab Bioinformatics Core
Street address 7, avenue des Hauts-Fourneaux
City Esch-Belval
State/province Luxembourg
ZIP/Postal code L-4362
Country Luxembourg
 
Platform ID GPL11345
Series (2)
GSE26216 Small RNA sequencing in Medicago truncatula roots (Glomus intraradices colonized and non-colonized)
GSE26218 Small RNA and degradome sequencing in Medicago truncatula roots (Glomus intraradices colonized and non-colonized)
Relations
SRA SRX036738
BioSample SAMN00189140

Supplementary file Size Download File type/resource
GSM643816_GDN-2.count.txt.gz 20.3 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Processed data provided as supplementary file
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap