 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 13, 2023 |
| Title |
Human cortex, Size-matched input, rep3 |
| Sample type |
SRA |
| |
|
| Source name |
Human frontal cortex (Brodmann area 4)
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Human frontal cortex (Brodmann area 4)
antibody: none
|
| Treatment protocol |
For iPSC-derived neurons, differentiated neurons seeded in 1x 6-well plate (~1x106 cells/well) were irradiated with ultraviolet (UV) light once at 400mJ/cm2 and once at 200 mJ/cm2 on iced water. For postmortem human brain BA4 region, the tissue (Brodmann Area 4) from each of three different donors was first pulverized in liquid nitrogen, and the powder in a chilled 10-cm tissue culture plate on dry ice was UV-crosslinked at 400 mJ/cm2 three times (Spengler et al., 2016).
|
| Growth protocol |
For generation of mature iPSC-neurons, we used a protocol, modified from a combination of previous studies (Telezhkin et al., 2016; Yan et al., 2013). Experiments were performed when neurons matured to day 40-50 of differentiation.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Crosslinked neurons or brain tissues were lysed in eCLIP lysis buffer (50 mM Tris-HCl pH 7.4, 100 mM NaCl, 1% NP-40 (Igepal CA630), 0.1% SDS, 0.5% sodium deoxycholate) containing proteinase inhibitor and RNAse inhibitor. Cell or tissue lysis was assisted with sonication by using a Bioruptor on the low setting for 5 min, cycling 30 s on and 30 s off. For each 1 mL lysate, 5 µL Turbo DNAse I (Thermo Fisher #AM2239) and high dose RNAse I (Thermo Fisher #AM2295; 1:5 diluted in cold DPBS) or low dose RNAse I (1:50 dilution for neurons, and 1:100 dilution for brain) were added. The microspin tubes were placed in a Thermomixer preheated to 37 °C for exactly 5 min, shaken at 1,200 rpm, and then put on ice to terminate the reaction.
Immunoprecipitated-RNA was dephosphorylated with FastAP enzyme (Thermo Scientific #EF0652) and T4 PNK (New England BioLabs #M0201L), and an adapter labeled with an IRDye®800CW fluorochrome (/5Phos/rNrNrNrN rArGrA rUrCrG rGrArA rGrArG rCrArC rArCrG rUrCrU rGrArA rArA/3IR800CWN/) was ligated to the 3′ end. Labeled RBP-RNA complexes were eluted using 1x LDS loading buffer (Thermo Fisher) and resolved on 4-12% Bis-Tris gels, transferred to nitrocellulose membrane, and imaged. RNA-protein complexes were visualized with LI-COR Odyssey imaging system, and a region including ~75 kDa above protein size (by comparing with high RNAse I sample) was cut from the membrane. RNA was isolated from the membrane via protease K/SDS treatment. After reverse transcription with a modified primer (5’-TTC AGA CGT GTG CTC TTC CG-3’), a 5′ adapter containing 8-nt UMI (/5phos/NNNNNNNN AGATCGGAAGAGCGTCGTGTAGGG/3ddC/) was ligated to cDNA. All of the remaining steps were essentially performed according to the eCLIP procedure (van Nostrand et al., 2016).
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
BA4_Input_3
|
| Data processing |
eCLIP libraries were demultiplexed, and inline random 8-mers were removed from the start of read 1 and appended to the read name using a script modified from the Yeo lab’s eclipdemux [https://github.com/YeoLab/eclipdemux]. Inline random 4-mers were removed from the start of read 2 using Trimmomatic v0.32.
Adapter sequences were removed in two rounds with Cutadapt v1.18 using commands recommended by ENCODE’s eCLIP-seq Processing Pipeline.
Paired-end reads were aligned to the human genome (GRCh38.primary_assembly.genome.fa, gencode.v39.primary_assembly.annotation.gtf) with STAR v2.7.1a (--alignEndsProtrude 15 ConcordantPair --outFilterMultimapNmax 100 --outSAMattributes NH HI AS NM MD). Multimappers were further filtered prior to peak calling (see peak calling below).
rRNA and tRNA tracks were downloaded from UCSC Table Browser (RepeatMasker's rmsk track and filtering for rRNA or tRNA), and rRNAs and tRNAs were removed in a two-step process. First, bedtools intersect (v2.15.0, -f 0.90) was used to identify all rRNA/tRNA reads. In the second step, qnames from round 1 were used to mask potentially multi-mapping rRNAs/tRNAs in the alignment file using Picard Tools v1.141 FilterSamReads.
PCR duplicate removal was performed using collapse_duplicates.py from the Xing lab (Zhang and Xing, 2017) with modifications.
Peak calling was performed using CLAM v1.2 (Zhang and Xing, 2017). Briefly, CLAM preprocessor was used to separate multi-mapped and uniquely mapped reads. Multi-mapped reads (--max-multihits of 10) were re-aligned to the genome with a probability. CLAM peakcaller was used in multi-replicate mode with size-matched input as background (n = 3 replicates each for IP and input) using default values for --qval-cutoff (0.05), --fold-change (2-inf), and --binsize (50). Finally, peak annotation was performed with CLAM peak_annotator.
bigWig files were prepared using Yeo lab’s makebigwigfiles [https://github.com/YeoLab/makebigwigfiles].
bigBed files were prepared using ENCODE's bedToBigBed.
Assembly: hg38
Supplementary files format and content: narrow_peak.combined.bb files contain CLAM peak calls in bigBed format
Supplementary files format and content: [BA4|iPSCNs]_[Input|PTBP2]_[rep].tar files contain minus/plus strand signal of unique reads in bigWig format
|
| |
|
| Submission date |
Jun 22, 2022 |
| Last update date |
Apr 13, 2023 |
| Contact name |
Jennine M Dawicki-McKenna |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Pennsylvania
|
| Department |
Physiology
|
| Street address |
700 CRB, 415 Curie Blvd
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104 |
| Country |
USA |
| |
|
| Platform ID |
GPL24676 |
| Series (2) |
| GSE206650 |
PTBP2 eCLIP from human iPSC-neurons and human cortex (Brodmann area 4) [CLIP-seq] |
| GSE206661 |
human iPSC-neurons and human cortex |
|
| Relations |
| BioSample |
SAMN29248098 |
| SRA |
SRX15824815 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6260042_BA4_Input_3_unique.sorted.neg.bw |
7.6 Mb |
(ftp)(http) |
BW |
| GSM6260042_BA4_Input_3_unique.sorted.pos.bw |
7.8 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
