 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 05, 2022 |
| Title |
LacZ_RNAi_Rep2_MNase |
| Sample type |
SRA |
| |
|
| Source name |
S2 cells
|
| Organism |
Drosophila melanogaster |
| Characteristics |
sirna: LacZ
|
| Treatment protocol |
Cells at 5 x 10 6 cells/ml were diluted 5- fold with serum-free M3 + BPYE + anti/anti and 150 μg dsRNA was added to 15 ml cells in T150 flasks. After incubating 45 min at 25⁰C, 15 ml of the same medium supplemented with 20% FBS was added to the cells. After 2.5 days another 150 μg dsRNA was added followed by 30 ml M3 + BPYE, anti/anti and 10% FBS, and the cells were split into two new flasks. After another 2.5 days the cells were harvested for isolation of nuclei. Synthesis of dsRNA used a dsDNA template with a T7 RNA polymerase promoter on both ends. The dsRNA was 668 bp for BEAF, 493 bp for Pbro, and 835 bp for LacZ. The DNA templates were generated by PCR using the following primers: BEAF forward (CTAATACGACTCACTATAGGGAGCAAGGCCAAGACGCTGAG); BEAF reverse (CTAATACGACTCACTATAGGGAGCGCTGATTTGCCCATTTAC); Pbro forward (CTAATACGACTCACTATAGGGAGCACTACTACGACATTATCAGGG); Pbro reverse (CTAATACGACTCACTATAGGGAGCTCTGTGCGGGACAACTTTC); control LacZ forward (GAATTAATACGACTCACTATAGGGAGAGATATCCTGCTGATGAAGC); LacZ reverse (GAATTAATACGACTCACTATAGGGAGAGCAGGAGCTCGTTATCGC).
|
| Growth protocol |
S2 cell tissue culture and RNAi treatment Drosophila S2 cells were grown at 25⁰C in M3 + BPYE medium with 10% fetal bovine serum (FBS) and antibiotic/antimycotic (anti/anti; 100 U/ml penicillin, 0.1 mg/ml streptomycin, 250 ng/ml amphotericin B) from 5 x 10e5 to 10e7 cells/ml.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells were treated with 1% formaldehyde for 2 min at room temperature, and cross- linking was quenched by adding glycine to 125 mM and placing the cells on ice. Nuclei were isolated as for PRO-seq (KWAK et al. 2013), except they were stored in MD buffer (10 mM Tris- HCl pH 8.0, 250 mM sucrose, 1 mM CaCl 2, 60 mM KCl, 15 mM NaCl, 1 mM DTT).
MNase digestions were done in 140 μl MD buffer on nuclei from 1.5 x 10e7 cells with 4000 U MNase (NEB gel units) at room temperature for 30 min, resulting in around 90% mononucleosomes. Reactions were stopped (360 μl 142 mM NaHCO 3, 1.42% SDS, 350 mM NaCl, 17.5 mM EDTA, 2.8 mM EGTA), DNA was isolated, and MNase-seq libraries were prepared as previously described (WEI et al. 2012). After 4 PCR cycles, DNA in the size range of 80 to 220 bp (not including adapter sequences) was isolated and sequenced.
|
| |
|
| Library strategy |
MNase-Seq |
| Library source |
genomic |
| Library selection |
MNase |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Libraries were sequenced by the Cornell Biotechnology Resource Center on an Illumina NextSeq 500. The six bar-coded MNase-seq libraries (biological replicates of the 3 RNAi treatments) were pooled and 2 x 32 nucleotide paired-end reads were obtained.
MNase-seq (paired-end) Fastq files were processed using the FastX toolkit (hannonlab.cshl.edu/fastx_toolkit/index.html) to filter, clip the Illumina adapters (fastx_clipper), trim to 26-mers (fastx_trimmer), and align to the Drosophila melanogaster dm3 reference genome with Bowtie2
bowtie2 -p 8 -X 250 --no-discordant --no-mixed –no-unal
Custom scripts were used with MNase-seq data to select 120 to 180 bp DNA fragments and calculate nucleosome centers. Nucleosome centers were used to create 50bp pseudo-fragments before converting to bigWig. Nucleosome centers were used to create 50bp pseudo-fragments before converting to bigwig.
Custom scripts: https://github.com/McKowen-JK/BEAF_Pbro
Genome_build: dm3
Supplementary_files_format_and_content: bigwig
|
| |
|
| Submission date |
Feb 28, 2022 |
| Last update date |
Mar 06, 2022 |
| Contact name |
Craig Hart |
| E-mail(s) |
[email protected], [email protected]
|
| Phone |
225-578-7389
|
| Organization name |
Louisiana State University
|
| Department |
Biological Sciences
|
| Lab |
Hart
|
| Street address |
Life Science Building, LSU
|
| City |
Baton Rouge |
| State/province |
Louisiana |
| ZIP/Postal code |
70808 |
| Country |
USA |
| |
|
| Platform ID |
GPL19132 |
| Series (2) |
| GSE197574 |
The Drosophila BEAF Insulator Protein Interacts with the Polybromo Subunit of the PBAP Chromatin Remodeling Complex [Mnase-seq] |
| GSE197584 |
The Drosophila BEAF Insulator Protein Interacts with the Polybromo Subunit of the PBAP Chromatin Remodeling Complex |
|
| Relations |
| BioSample |
SAMN26309478 |
| SRA |
SRX14311092 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5920752_mnase_lz2.bw |
148.4 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
