NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM5667105 Query DataSets for GSM5667105
Status Public on Mar 01, 2022
Title DSP-1010992704701-G-G11
Sample type SRA
 
Source name adult mouse FFPE tissue
Organism Mus musculus
Characteristics strain: C57
panel: (v1.0) 06 E2E Set 1 WTA, (v1.0) 07 E2E Set 2 WTA, (v4.0) Mouse Whole Transcriptome Dev
roilabel: 026
area: 70787.41
tissue: Colon
Extracted molecule other
Extraction protocol Samples were incubated with the mouse Whole Transcriptome Atlas RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with fluorescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x)
Each collection of oligo tags from one well (representing an AOI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR.  After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio.
 
Library strategy OTHER
Library source transcriptomic
Library selection other
Instrument model Illumina HiSeq 2000
 
Data processing Library strategy: GeoMx Seq
GeoMx NGS Pipeline v2.3.3.10 with the following parameters: quality-trim-score = 20, 2color-trimming = True, adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC, adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT, adapter-trim-match-length = 10, adapter-trim-max-mismatch = 3, barcode-max-mismatch = 1, stitching-max-mismatch = 2
Genome_build: NA
Supplementary_files_format_and_content: Digital Count Conversion (DCC) files: format outputted from GeoMx NGS Pipeline, contains software versions, scan attributes, GeoMx NGS pipeline parameters and output metrics, Q30 scores, and list of deduplicated counts per RTS_ID (probe barcode)
Supplementary_files_format_and_content: mouse_organs_RawCounts: xlsx file outputted from the GeoMx DSPDA analysis software containing sample annotations, probe information, and raw probe count matrix for each probe and sample
Supplementary_files_format_and_content: mouse_organs_CollapsedTargetCounts: xlsx file outputted from the GeoMx DSPDA analysis software containing sample annotations, processing information, and target-level count matrix for each gene target and sample
Supplementary_files_format_and_content: mouse_organs_NormalizedCounts: xlsx file outputted from the GeoMx DSPDA analysis software containing sample annotations, processing information, and Q3 normalized count matrix for each gene target and sample, filtered for genes expressed above background
 
Submission date Nov 02, 2021
Last update date Mar 02, 2022
Contact name Stephanie Zimmerman
E-mail(s) [email protected]
Organization name NanoString Technologies
Street address 530 Fairview Ave N
City Seattle
State/province WA
ZIP/Postal code 98109
Country USA
 
Platform ID GPL13112
Series (2)
GSE187013 Spatially resolved whole transcriptome profiling in human and mouse tissue using Digital Spatial Profiling [mouse organ array]
GSE190089 Spatially resolved whole transcriptome profiling in human and mouse tissue using Digital Spatial Profiling
Relations
BioSample SAMN22841424
SRA SRX12906186

Supplementary file Size Download File type/resource
GSM5667105_DSP-1010992704701-G-G11.dcc.gz 74.5 Kb (ftp)(http) DCC
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap