GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5418740

Query DataSets for GSM5418740

Status

Public on Jan 05, 2022

Title

Abisporus csRNA-seq rep3

Sample type

SRA

Source name

Agaricus bisporus fruiting body

Organism

Agaricus bisporus

Characteristics

strain: white
tagtreatment: untreated
method: csRNA-seq

Treatment protocol

untreated

Growth protocol

C. immitis R.S. strain was grown as mycelia or spherules as previously described (Viriyakosol et al. 2013). To grow mycelia, 2×10^6 arthroconidia/ml were incubated in 250 ml flat-bottom Erlenmeyer flasks (Corning) in 50 ml GYE media. Flasks were cultured in a 30°C incubator without shaking for 5 days. To grow spherules, arthroconidia were washed 2 times in modified Converse media (Converse 1956). The spores were inoculated at 4×106 arthroconidia/ml into a 250 ml baffled Erlenmeyer flask containing 50 ml of modified Converse media. Flasks were set up and grown on a shaker at 160 rpm, in 14% CO2 at 42°C. Four flasks were harvested 2 days after inoculation and the remaining four flasks after 8 days. Fresh Converse media was not added. The spherules did not rupture and release endospores within that time in this culture system. Saccharomyces cerevisiae (strain RYH2863) was grown as described previously (Neal et al. 2018). Schizosaccharomyces pombe (strain TH972) was generously provided by Tony Hunter (SALK Institute for Biological Sciences) and grown in Yeast Extract with Supplements (YES)(Leverson et al. 2002). White and brown ecotypes of Agaricus bisporus, better known as ‘Champignon’ or ‘crimini mushroom’ were kindly provided by Monterey Mushroom farms.

Extracted molecule

total RNA

Extraction protocol

Trizol extraction after tissue homogenisation
For RNA-Seq, strand-specific, paired-end libraries were prepared from total RNA by ribosomal depletion using the Yeast Ribo-Zero rRNA Removal Kit (Illumina) and then using the TruSeq Stranded total RNA-Seq kit (Illumina) according to manufacturer's instructions. Then 100 bases were sequenced from both ends using a HiSeq 4000 according to the manufacturer's instructions (Illumina). csRNA-seq was performed as described in (Duttke et al. 2019). Small RNAs of ~20-60 nt were size selected from 0.4-2 µg of total RNA by denaturing gel electrophoresis. A 10% input sample was taken aside and the remainder enriched for 5’-capped RNAs. Monophosphorylated RNAs were selectively degraded by Terminator 5´-Phosphate-Dependent Exonuclease (Lucigen) and RNAs were 5’dephosporylation by quickCIP (NEB). Input (sRNA) and csRNA-seq libraries were prepared as described in (Hetzel et al. 2016) using RppH (NEB) and the NEBNext Small RNA Library Prep kit, amplified for 14 cycles and sequenced SE75 on the Illumina NextSeq 500.
csRNA-seq, sRNA-seq, total RNA-seq

Library strategy

ncRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina NextSeq 500

Description

abisporus-tsr.txt

Data processing

For csRNA-seq, sequencing reads were trimmed for 3’ adapter sequences using HOMER (“homerTools trim -3 AGATCGGAAGAGCACACGTCT -mis 2 -minMatchLength 4 -min 20”) and aligned to the appropriate genome using STAR with default parameters[PMID: 23104886]. Only reads with a single, unique alignment (MAPQ >=10) were considered in the downstream analysis. Furthermore, reads with spliced or soft clipped alignments were discarded. Transcription Start Regions (TSRs), representing loci with significant transcription initiation activity (i.e. ‘peaks’ in csRNA-seq), were defined using HOMER’s findcsRNATSS.pl tool, which uses short input RNA-seq, traditional total RNA-seq, and annotated gene locations to eliminate loci with csRNA-seq signal arising from non-initiating, high abundance RNAs that nonetheless are captured and sequenced by the method (Duttke et al. for more details[PMID:31649059]). Replicate experiments were first pooled to form meta-experiments for each condition prior to identifying TSRs. Annotation information, including gene assignments, promoter distal, stable transcript, and bidirectional annotations are provided by findcsRNATSS.pl.
For RNA-seq, reads from accession GSE171286 were downloaded and aligned to the C. immitis genome (ASM14933v2) using STAR with default parameters. Reference-guided transcranscript assembly was performed using StringTie2 (Kovaka et al. 2019) with the Ensembl gene annotation (GTF file) and additional parameters “-m 100 --rf”. Assembled transcripts were compared to the existing C. immitis annotation using cuffcompare.
Genome_build: C. immitis (ASM14933v2), S. cerevisiae (R64-1-1/sacCer3), S. pombe (ASM294v2), A. bisporus (gca_000300555/Agabi_varbur_1)
Supplementary_files_format_and_content: Tab-delimited Text file describing TSR positions and annotations, GTF formated transcript definition files

Submission date

Jul 05, 2021

Last update date

Jan 05, 2022

Contact name

Christopher Benner

E-mail(s)

[email protected]

Organization name

University of California, San Diego (UCSD)

Department

Medicine