GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5259581

Query DataSets for GSM5259581

Status

Public on Apr 23, 2021

Title

B1 Chemical Mapping - NM

Sample type

SRA

Source name

in vitro transcribed

Organism

synthetic construct

Characteristics

tissue: in vitro transcribed
treatment: NM

Extracted molecule

total RNA

Extraction protocol

In vitro treated RNAs were purified by Zymo RNA Clean and Concentrator 5 kit.
10 µL of the modified RNA was mixed with 1 µL of 10 µM oVT555 (GACGCCGTACGTACGCGG), incubated at 65 °C for 5 min, and snap cooled on ice. Then, the template-primer mix was combined with 4 µL of 5X TGIRT First Strand Synthesis Buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl2 ), 2 µL 10 mM dNTPs, 1 µL freshly prepared 100 mM DTT, and 0.5 µL TGIRT-III (InGex LLC). The reaction was mixed and incubated at 57 °C for 3 hours. RNA was then hydrolyzed by addition of 10 µL hydrolysis buffer (0.5 M NaOH, 0.25 M EDTA) and incubation at 65 °C for 15 min. Hydrolysis was quenched by bringing the reaction volume to 50 µL with water, adding 100 µL of Oligo Binding Buffer (Zymo Research), and proceeding through the Zymo Oligo Clean and Concentrator (Zymo Research) purification protocol, eluting in 15 µL of water. 5 µL of the purified cDNA was amplified in a NEBNext Q5 HotStart master mix PCR reaction containing 0.5 µM each oVT554 (GGGACATTTGCTTCTGACACAACTGTGTTCA) and oVT555 (GACGCCGTACGTACGCGG) with the following cycling conditions: 98 °C for 30 seconds, 10 cycles of 98 °C for 10 seconds followed by 72 °C for 60 seconds, with a final extension of 72 °C for 5 minutes. Products were purified using 0.9X Select-a-Size DNA Clean and Concentrator MagBeads (Zymo Research).Amplification of the full-length cDNA product was verified on an agarose gel stained with SYBRSafe (Invitrogen). Double-stranded cDNA was prepared for Illumina sequencing with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs) and iTru primers. Briefly, 100-500ng of DNA from either 1M7 or DMS conditions in 26 µL of water was fragmented and end-repaired by adding 7 µL NEBNext Ultra II FS Reaction Buffer and 2 µL NEBNext Ultra II FS Enzyme Mix, mixed thoroughly by vortexing, and incubated in a thermocycler with heated lid on at 37°C for 20 min, then 65°C for 20 min. Fresh ligation adapter was prepared by denaturing a solution of 15 µM each of iTrusR1-stub (ACACTCTTTCCCTACACGACGCTCTTCCGATC*T) and iTrusR2-stubRCp (/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCA*C) in salty TLE (10 mM Tris pH 8.0, 0.1 mM EDTA, 100 mM NaCl) at 95°C for 1 minute, then annealed via slow cooling at -0.1°C/s to 25°C. The fragmented and end-repaired DNA was mixed with 2.5 µL 15 µM ligation adapter, 30 µL NEBNext Ultra II FS Ligation Master Mix, and 1 µL NEBNext Ultra II FS Ligation Enhancer. The ligation reaction was incubated in a thermocycler (heated lid off) at 20°C for 60 min. Ligated fragments were purified with 0.9X Select-a-Size DNA Clean and Concentrator MagBeads (Zymo Research) and eluted in 25 µL water. Dual-index sample barcodes were added through indexing PCR using the NEBNext Q5 Hot Start HiFi PCR Master Mix in a reaction with 0.5 µM each of iTru_5 and iTru_7 indexing primers with the following thermocycling parameters: 98°C for 30 s, 8 cycles of 98°C for 10 s, 55°C for 10 s, 72°C for 15 s, and a final extension at 72°C for 5 min. The final sequencing libraries were purified with 0.9X volumes of Select-a-Size DNA Clean and Concentrator MagBeads (Zymo Research)

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina MiSeq

Data processing

Library strategy: Barcode amplicon sequencing
Demultiplexed reads were downloaded from the BaseSpace Sequence Hub (Illumina). Most analysis steps were carried out using the RNAFramework RNA structure probing analysis toolkit. Using the `rf-map` module, reads were trimmed with CutAdapt and mapped to the wild-type RNA sequence using Bowtie 2. Mutations were counted using the `rf-count` module with `-m` flag, then normalized using the `rf-norm` module with `-sm 4 -nm 2 -rb AC -nw 50 -dw` flags for DMS samples and `-sm 3 -nm 2 -rb N -nw 50 -dw` flags for 1M7 samples. These normalized reactivities were plotted as-is, and also used to predict RNA secondary structure using the RNAStructure `Fold` command, implemented in Arnie (https://github.com/DasLab/arnie).
processed data files format and content: Table S4 contains normalized nucleotide-resolution reactivities of YellowStone, LinearDesign, and P4P6 (positive control) constructs. DMS reactivity signals are provided for all three constructs, and 1M7 reactivity signals are provided for YellowStone and LinearDesign.

Submission date

Apr 22, 2021

Last update date

Apr 23, 2021

Contact name

Rhiju Das

E-mail(s)

[email protected]

Organization name

Stanford University School of Medicin

Department

Biochemistry