GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5259552

Query DataSets for GSM5259552

Status

Public on Apr 23, 2021

Title

RNA in-solution timepoint 3

Sample type

SRA

Source name

Cell culture

Organism

Homo sapiens

Characteristics

tissue: HEK293T cell line

Extracted molecule

total RNA

Extraction protocol

RNA was purified using Ampure beads + 40% polyethylene glycol 8000 (7:3)
Up to 250 ng RNA in 2.75 µL was mixed with 0.25 µL 2 µM RT_Const2_N12_Read1Partial (TCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNtcaccacggcgtgagatcagcg) and 0.25 µL 10mM dNTPs each. The RNA samples were then denatured at 65°C for 5 min and chilled to 4°C. 1.75 µL reverse transcription mix was added to 5 µL total reaction volume: 1 µL 5x Superscript IV buffer, 0.25 µL 10mM DTT, 0.25 µL Superase-In (ThermoFisher Scientific, AM2694), 0.25 µL Superscript IV (Thermo 18091050). The reaction was incubated at 55°C for 45 min and inactivated at 80°C for 10 min. First round PCR was performed under following conditions: 1 µL RT reaction, 10 µL 2x Q5 Hot Start Master Mix (NEB M0494S), 0.2 µL 100x SYBR (Thermo S7563), 1 µL 10uM Read1Partial_F (TCTTTCCCTACACGACGCTCTTCCGATCT), 1 µL 10 uM 50:50 Hbb_Fwd:Nluc_Fwd mix in 20 µL total volume. Cycling conditions were: 98°C for 60 sec, and 15 cycles of 98°C for 10 sec, 68°C for 10 sec and 72°C. Second round PCR was performed under the following conditions: 1 µL first round PCR, 10 µL 2x Q5 Hot Start Master Mix, 0.2 µL 100x SYBR, 1 µL 10 uM Read1Partial_F, 1 µL 10 uM Read2Partial_Const1_R (GGAGTTCAGACGTGTGCTCTTCCGATCTttctagagcggccgcttcgagc) in 20 µL total volume. Cycling conditions were: 98°C for 60 sec, and 5 cycles of 98°C for 10 sec, 72°C for 5 sec. Sequencing adaptors were added using the following conditions for final round PCR: 1 µL second round PCR, 10 µL 2x Q5 Hot Start Master Mix, 0.2 µL 100x SYBR, 1 µL 10 µM NEBNext Index Primer (NEB E7335, NEB E7500, NEB E7710, NEB E7730, NEB E6609), 1 µL 10 µM NEBNext Universal PCR Primer in 20 µL total volume. Cycling conditions were: 98°C for 60 sec, and 5 cycles of 98°C for 10 sec, 72°C for 5 sec. All barcoded samples were then pooled at equal volumes and purified with 1.1x SPRIselect beads (Beckman Coulter B23317).

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

NextSeq 550

Data processing

Library strategy: Barcode amplicon sequencing
Constant regions were trimmed using cutadapt. The trimmed reads were aligned to the indexed reference of barcode sequences using Bowtie2 with the following options: -L 11 -N 0 --nofw 89. The alignments were deduplicated based on UMIs using UMIcollapse with -p 0.05 and counted using samtools available under idxstats. This pipeline yields a matrix of barcode read counts where rows are the different constructs in the library and columns are the different samples. The count matrix was log transformed and normalized column-wise using a linear fit on the dilution series of spike-in constructs in each sample. For the calculation of RNA degradation coefficients in cells, we carried out a linear fit to log RNA abundance from the time course data, i.e. we fit an expression of Y = β0+β1 t where Y is the normalized log RNA abundance and t is the number of hours after transfection; β1 is the degradation constant. For the calculation of in solution degradation coefficients, sufficient data points were available to carry out a nonlinear fit directly to an exponential model, i.e. we fit an expression of y = A exp(-𝛕/t), where y is the fraction intact (RNA abundance normalized to initial abundance), A is the amplitude, t is the time of incubation in degradation buffer in hours, and 𝛕 is the degradation time constant. For polysome profiles, percent RNA abundances for each fraction were first calculated by scaling per-fraction values by the sum of all fractions. For the heatmap displays in the figures, column medians were also subtracted from each percent RNA value. For the calculation of ribosome load, the matrix of percent RNA abundances in fractions 4-9 (1-3 are free RNP fractions, and >9 have negligible abundance) were first multiplied by a weight vector representing the number of ribosomes in each fraction as determined by the A260 trace from the fractionator, then the weighted abundances were summed across the row. For the calculation of polysome to monosome ratio, the sum of fractions 7-9 (>3 ribosomes) abundances were divided by fraction 4 (80S) abundance. For the calculation of monosome to 40S/60S ratio, fraction 4 (80S) abundance was divided by the sum of fraction 2 (40S/60S) abundance.
processed data files format and content: Table S1 is an XLSX file containing the final polysome profile metrics and degradation statistics for each of the 233 constructs in the input library.

Submission date

Apr 22, 2021

Last update date

Apr 23, 2021

Contact name

Rhiju Das

E-mail(s)

[email protected]

Organization name

Stanford University School of Medicin

Department

Biochemistry