|
| Status |
Public on Mar 01, 2021 |
| Title |
SNT_TE4.5_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
SNT_TE4.5
|
| Organism |
Mus musculus |
| Characteristics |
strain: B6D2F1 (C57BL/6 x DBA/2)
cell type: E4.5 blastocysts trophoectoderm
embryo source: nuclear transfer with HDACi
|
| Treatment protocol |
We transferred E4.5 blastocysts onto MMC-treated ICR mouse MEFs and firstly culture in TSC medium composed 70% FCM, 30% TSM and 1 x F4H medium. Then, we collected and disaggregated outgrowths (100 μm) at 5–7 days later, and changed the TSC medium to 1.5 x F4H instead. TSC-likely colony emerged at day 12~15. Then, the medium was changed back to 1 x F4H medium.
|
| Growth protocol |
We generated embryos from 3 different sources natural fertilization (NF), somatic nuclear transfer (NT), and somatic nuclear transfer with HDACi Scriptaid treatment (SNT)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For RNA-seq, we performed reverse transcription directly on the cytoplasmic lysate and used terminal deoxynucleotidyl transferase to add a poly(A) tail to the 3' end of the first-strand cDNAs. We amplified the total cDNA library by 18-20 cycles. Afterward, we fragmented the amplified cDNA by Covaris sonicator (Covaris S220, USA) and used the TruSeq Library Prep Pooling kit (Illumina 15042173, USA) to generate the RNA sequence libraries.
Illumina HiSeq 2500
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
SNT_TE4.5.rep2
|
| Data processing |
Illumina Casava1.8 software used for basecalling.
RNA-seq reads were removed adaptor and low-quality reads using cutadapt (1.11) by parameters -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -m 50 -q 20, and then aligned to mm10 transcript genome using STAR (020201) by parameters --readFilesCommand zcat --runThreadN 8 --outFilterMismatchNmax 3. Uniquely mapped reads were subsequently assembled into known transcripts (iGenome mm10) with featureCounts (v1.6.1). The reads count of genes were normalized by library size using edgeR and differential expressed genes were defined by the cutoff log2foldchange >2 and padj<0.01 using by DESeq2.
Genome_build: mm10
Supplementary_files_format_and_content: Tab-delimited text file include log2(CPM) of all samples
|
| |
|
| Submission date |
Dec 16, 2020 |
| Last update date |
Mar 01, 2021 |
| Contact name |
Jin Sun |
| E-mail(s) |
[email protected]
|
| Organization name |
Tongji University
|
| Department |
life science and technology
|
| Lab |
Jiang
|
| Street address |
siping1239
|
| City |
shanghai |
| ZIP/Postal code |
200092 |
| Country |
China |
| |
|
| Platform ID |
GPL17021 |
| Series (2) |
| GSE163379 |
DNA methylation abnormal accumulation during cloned TSCs maintaining [RNA-seq] |
| GSE163381 |
DNA methylation abnormal accumulation during cloned TSCs maintaining |
|
| Relations |
| BioSample |
SAMN17098680 |
| SRA |
SRX9694478 |
