 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 23, 2021 |
| Title |
HCT116 cells pCDNA3.0 pri-mir-342midB_5p plasmid replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
HCT116 cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HCT116
disease state: colon carcinoma
plasmid transfection: pCDNA3.0 pri-mir-342midB_5p plasmid
index: GGAACT
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs were extracted using TRIzol reagent.
1.5 μg of pcDNA3.0 plasmids encoding pri-mir-342 or its variants plus 0.5 μg of pcDNA3.0 encoding pri-mir-1266 were co-transfected into HCT116 cells pre-seeded in one well of 6-well plate using lipofectamine 3000 (Thermo Fisher Scientific). One and a half days after transfection, total RNAs were extracted from the transfected cells using TRIzol reagent (Invitrogen). Fifteen μg of each total RNA was loaded into 15% urea-PAGE. The small RNAs within the 19-24 nt region were gel-purified. The purified small RNAs were ligated to the 3’-adapter (4N-RA3) using T4 RNA ligase 2, truncated KQ (NEB). The 3’-adapter ligated RNAs were separated from free 3’-adapter and unligated small RNAs by gel-purification. After which, the purified 3’-adapter RNAs were ligated with 5’-adapter (RA5-4N) using and T4 RNA ligase 1 (NEB). Next, the 3’- and 5’-adapter-ligated RNAs were reverse transcribed using SuperScript™ IV Reverse Transcriptase with the R-RA3 primer, which generated cDNAs. The resulting cDNAs were amplified using PCR with RP1 and RPI primer (Illumina), which produced DNA libraries. We used a RPI primer with a unique index sequence for each small RNA sample.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
The raw paired-end reads were trimmed to remove 3p- and 5p-adapters using cutadapt (cutadapt -a TGGAATTCTCGGGTGCCAAGG -A GATCGTCGGACTGTAGAACTCTGAAC) (Martin 2011). The resulting trimmed reads were joined using fastq-join. The low quality reads and duplicated reads were discarded using fastq_quality_filter (-q 30 -p 90) and fastx_collapser (FASTX-Toolkit, http://hannonlab.cshl.edu/fastx_toolkit/index.html, version 0.0.13), respectively. Next, the 4-nt randomized barcodes in both ends of reads were trimmed. The reads were mapped to the sequence of transfected pri-mir-342 or its variants using BWA (Li and Durbin, 2009). Pri-mir-342 variants were designed to introduce the bulge or delete the mismatches on the upper stem of pri-mir-342 wild type. Since the 3p-end annotation of miRNAs are not accurate due to the modifications, we used the 5p miRNAs for cleavage site analysis.
Genome_build: GRCh38
Supplementary_files_format_and_content: raw read count, transfected_primiRNAs.fasta.gz contains the sequence of transfected pri-mir-342 and its variants
|
| |
|
| Submission date |
Sep 16, 2020 |
| Last update date |
Aug 23, 2021 |
| Contact name |
Duc Trung Nguyen |
| E-mail(s) |
[email protected]
|
| Phone |
+582 53345859
|
| Organization name |
The Hong Kong University of Science and Technology
|
| Department |
Life Science
|
| Lab |
Anh Lab
|
| Street address |
Clear Water Bay
|
| City |
Hong Kong |
| ZIP/Postal code |
999077 |
| Country |
Hong Kong |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE158060 |
The bulges control in pri-miRNA processing in the position and strand-dependent manner |
|
| Relations |
| BioSample |
SAMN16181770 |
| SRA |
SRX9134537 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4787725_342_midB_5p_rep1_count.txt.gz |
2.1 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
