 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 27, 2021 |
| Title |
CJ_CG84-21_dRNA_R2_minus_TEX |
| Sample type |
SRA |
| |
|
| Source name |
Campylobacter jejuni CG84-21 cells
|
| Organism |
Campylobacter jejuni subsp. jejuni CG8421 |
| Characteristics |
strain: CG84-21
tex: untreated
replicate: replicate 2
|
| Treatment protocol |
No treatment applied during growth.
|
| Growth protocol |
Bacterial cells grown to mid-log in Brucella Broth media at 37° C, 140 rpm agitation in microaerobic environment (10% CO2, 5% O2, 85% N2) of HERAcell 150i incubator.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was purified using Hot-Phenol RNA isolation method from C.jejuni CG84-21 cells and used for TEX treatment.
Briefly, total RNA isolated from CG84-21 was treated with DNase I, and equal amounts of Campylobacter RNA were incubated with Terminator™ 5′-phosphate-dependent exonuclease (TEX) (Epicentre, cat. #TER51020) for depletion of processed transcripts as previously described(2)(9). cDNA libraries for Illumina sequencing were then constructed by Vertis Biotechnologie AG, Germany (http://www.vertis-biotech.com) in a strand-specific manner (2)(9). In brief, RNA samples were poly(A)-tailed using poly(A) polymerase. Then, 5′-triphosphates were removed using tobacco acid pyrophosphatase (TAP), and an RNA adaptor was then ligated to the resulting 5′-monophosphate. First-strand cDNA was synthesized with an oligo(dT)-adaptor primer using M-MLV reverse transcriptase. A PCR-based amplification step was then conducted with a high-fidelity DNA polymerase to increase the cDNA concentration to 10-20 ng/μL. For all libraries, the Agencourt AMPure XP kit (Beckman Coulter Genomics) was used to purify the DNA, which was subsequently analyzed by capillary electrophoresis. A library-specific barcode for multiplex sequencing was included as part of a 3′-sequencing adaptor. The following adaptor sequences flank the cDNA inserts: TruSeq_Sense_primer: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ TruSeq_Antisense_NNNNNN_primer: 5′-CAAGCAGAAGACGGCATACGAGAT-NNNNNN-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC(dT25)-3′ (NNNNNN = 6nt barcode for multiplexing):
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
FASTQ quality and adapter trimming using Cutadapt (Martin, 2011) version 2.5 (cutadapt parameters: -q 20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC)
Alignment of reads longer than 11 nt to reference genome using segemehl version 0.2.0 with minimum accuracy 95% after poly(A)-trimming (parameters for reademption align: -l 12 -c -a 95 ) (READemption 0.4.5, Förstner et al., 2014)
Coverage calculation via reademption coverage based on all aligned reads (full-length); Normalization: coverage-tnoar_mil_normalized (counts divided by total number of aligned reads and multiplied by 1,000,000) (READemption 0.4.5, Förstner et al., 2014)
Genome_build: Campylobacter jejuni CG84-21 (Assembly acc.: GCF_000171795.2, Sequence ID: NZ_CP005388.1)
Supplementary_files_format_and_content: wiggle files containing positional read coverage values
|
| |
|
| Submission date |
Aug 14, 2020 |
| Last update date |
Apr 28, 2021 |
| Contact name |
Tom Gräfenhan |
| E-mail(s) |
[email protected]
|
| Phone |
+49 - 931 - 31 - 80814
|
| Organization name |
University of Wuerzburg
|
| Department |
Core Unit SysMed
|
| Lab |
Raum D15.02.045
|
| Street address |
Josef-Schneider-Str. 2, Bau D15
|
| City |
Würzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL29024 |
| Series (2) |
| GSE156265 |
Non-canonical crRNAs derived from host transcripts enable multiplexable RNA detection by Cas9 [dRNA-seq] |
| GSE156266 |
Non-canonical crRNAs derived from host transcripts enable multiplexable RNA detection by Cas9 |
|
| Relations |
| BioSample |
SAMN15822558 |
| SRA |
SRX8948777 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4728011_CJ_CG84-21_dRNA_R2_minus_TEX_forward.wig.gz |
4.4 Mb |
(ftp)(http) |
WIG |
| GSM4728011_CJ_CG84-21_dRNA_R2_minus_TEX_reverse.wig.gz |
4.7 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
