|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 12, 2021 |
Title |
Scer_ox_trm7_rep3 |
Sample type |
SRA |
|
|
Source name |
trm7Δ oxidized tRNA
|
Organism |
Saccharomyces cerevisiae |
Characteristics |
strain: BY4741 treatment: 50mM NaIO oxidation and sodium borate β-elimination. 42C, 75mM KCl, 16 hour primer-dependant RT reaction
|
Treatment protocol |
To measure tRNA charging levels, RNA oxidation and β-elimination were performed as described (Clark et al., 2016) with minor modifications. 25 µg of total RNA were resuspended in 10 mM sodium acetate pH 4.5 and oxidized by the addition of freshly prepared NaIO4 to a final concentration of 50 mM in a 58-µL volume for 30 min at 22°C. The reaction was quenched by addition of 6 µL 1 M glucose for 5 min at 22°C. RNA was purified with Micro Bio Spin P30 columns (BioRad) followed by two rounds of ethanol precipitation. Pellets were resuspended in 20 µL RNAse-free water and β-elimination was performed by addition of 30 µl 100 mM sodium borate pH=9.5 (freshly prepared) for 90 min at 45°C. RNA was recovered with Micro Bio Spin 30 columns followed by ethanol precipitation.
|
Growth protocol |
S. cerevisiae cells (BY4741 wild-type, trm7∆, trm1∆, and trm10∆ Euroscarf) were grown in yeast extract-peptone-dextrose (YPD) medium. D. melanogaster BG3-c2 cells were cultured at 26℃ in Schneider’s Drosophila Medium (Gibco) supplemented with 10% fetal calf serum, 1% penicillin/streptomycin, and 10 µg/ml human insulin. HEK293T cells were grown at 37℃ in DMEM supplemented with 10% fetal bovine serum (Sigma Aldrich). The kucg2 human induced pluripotent stem cell line (obtained from HipSci24) was cultured at 37oC in mTeSR1 (STEMCELL Technologies).
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA from Drosophila BG3-c2, HEK293T, and human iPS cells was isolated with Trizol (Sigma Aldrich) according to the manufacturer’s instructions. For total RNA isolation from yeast, frozen cells were resuspended in 100 mM sodium acetate pH=4.5, 10 mM EDTA pH=8.0, 1% SDS (1 ml per 50 OD600 units). An equal volume of hot acid phenol (pH=4.3) was added, and the cell suspension was vortexed vigorously followed by incubation at 65℃ for 5 min with intermittent mixing. After addition of 1/10 volume 1-Bromo-3-chloropropane (BCP, Sigma Aldrich), samples were centrifuged at 10,000 x g for 5 min and the aqueous phase was transferred to a new tube. Following an additional round of hot acid phenol/BCP and a round of BCP only extraction, RNA was precipitated from the aqueous phase by the addition of 3 volumes of ethanol. For RNA isolation from yeast under conditions that preserve tRNA charging, frozen cells were resuspended in ice-cold 100 mM sodium acetate pH=4.5, 10 mM EDTA pH=8.0. One volume of cold acid phenol (pH=4.3) was added and cells were lysed with glass beads. One-tenth volume of BCP was then added and the samples were centrifuged at 10,000 x g/4℃ for 5 min, followed by a second round of cold phenol-BCP and one round of BCP-only extraction. RNA was ethanol-precipitated from the aqueous phase and pellets were washed in 80% ethanol containing 50 mM sodium acetate, pH=4.5, briefly air-dried, and resuspended in 50 mM sodium acetate pH=4.5, 1 mM EDTA pH=8.0. Two synthetic standards corresponding to E.coli tRNALys(UUU) with intact 3’-CCA (5’-GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCA-3’) or a 3’-CC (5’- GGGTCGTTAGCTCAGTTGGTAG AGCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACC-3’) were added to 5 - 10 µg of total RNA in a 3:1 molar ratio at 0.06 pmol/µg, followed by incubation at 37oC in 50 mM Tris-HCl pH=9.0 to deacylate tRNAs. Deacylation was omitted for samples subjected to oxidation and β-elimination. Total RNA was subsequently dephosphorylated and purified by ethanol precipitation in 0.3M sodium acetate pH=4.5 with 25 µg glycogen (Ambion) as a carrier. RNA was resolved on a denaturing 10% polyacrylamide/7M urea/1xTBE gel and species migrating at the size range of mature tRNAs (60 – 90 nt) were excised and gel slices were crushed with disposable pestles. Following addition of 400 µl gel elution buffer (0.3M sodium acetate pH=4.5, 0.25% SDS, 1mM EDTA pH=8.0), the gel slurry was incubated at 65℃ for 10 min, snap-frozen on dry ice, and thawed at 65℃ for 5 min. RNA was eluted overnight at room temperature with continuous mixing. Gel pieces were removed with Costar Spin-X centrifuge tube filters and RNA was recovered from the flow-through by ethanol precipitation in the presence of 25 µg of glycogen. 50 to 200 ng of gel-purified tRNA was ligated to one of four adapters with distinct barcodes.Ligation was performed for 3 hours at 25°C in a 20-µl reaction volume containing pre-adenylated adapter and RNA substrate in a 4:1 molar ratio, 1x T4 RNA Ligase Reaction Buffer, 200 U of T4 RNA ligase 2 (truncated KQ; NEB), 25% PEG 8000, and 10 U SUPERase In (Ambion). Ligation products were separated from excess adapter on denaturing 10% polyacrylamide/7M urea/1xTBE gels. Bands migrating at 95-125 nt were excised and ligation products were recovered from crushed gel slices. Reverse transcription reactions contained 125 nM adapter-ligated tRNA pool, 125 nM primer(5’pRNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG/iSp18/GTGACTGGAGTTCAGACGTGTGCTC-3’) and 500 nM TGIRT (InGex) in a final volume of 20 µl. Reactions were performed in 50 mM Tris-HCl pH=8.3, 75 mM KCl, 3 mM MgCl2, 5 mM DTT (from a freshly made 100 mM stock), and 10 U SUPERase In. After TGIRT addition, reactions were pre-incubated at 42℃ for 10 min, initiated by addition of dNTPs to a final concentration of 1.25 mM, and incubated at 42℃ for 16 hours in a Themrocycler. For Superscript III RT, template and primer were denatured at 75℃ for 5 min and chilled on ice, and reverse transcription was performed in the presence of 1X First-Strand Buffer, 5 mM DTT, 0.5 mM dNTPs, 10 U SUPERase In, and 200 U Superscript III (Invitrogen) at 57℃ for 60 min. Template RNA was hydrolyzed by the addition of 1 µl 5M NaOH and incubation at 95℃ for 3 min. cDNA between 60 and 150 nt was excised and cDNA was eluted from crushed gel slices in 400 µl 10 mM Tris-HCl pH=8.0, 1 mM EDTA at 70℃/2000 rpm for 1 hour in a Thermoblock, followed by ethanol precipitation. Purified cDNA was circularized with CircLigase ssDNA ligase (Lucigen) in 1x reaction buffer supplemented with 1 mM ATP, 50 mM MgCl2, and 1M betaine for 3 hours at 60℃, followed by enzyme inactivation for 10 min at 80℃. One-fifth of circularized cDNA was directly used for library construction PCR. Amplification was performed with KAPA HiFi Polymerase in 1x GC buffer with initial denaturation at 95℃ for 3 min, followed by five to six cycles of 98℃ for 20 sec, 62℃ for 30 sec, 72℃ for 30 sec. PCR products were purified with DNA Clean&Concentrator (Zymo Research) and resolved on 8% polyacrylamide/1xTBE gels alongside pBR322 DNA-MspI Digest (NEB). The 130-220 bp region of each lane was excised and DNA was eluted from crushed gel slices in 400 µl water with continuous mixing at room temperature overnight. After ethanol precipitation in 0.3M sodium acetate pH=5.5 and 25 µg glycogen, libraries were dissolved in 10 µl 10 mM Tris-HCl pH=8.0, quantified with Qubit, and sequenced for 150 cycles on an Illumina NextSeq platform.
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
Scer_anticodon_counts.csv Scer_isodecoder_counts.csv
|
Data processing |
Read demultiplexing and adapter trimming performed with cutadapt v2.5, where bases were quality trimmed from 5' and 3' ends using a phred score cutoff of 30. Only trimmed reads were retained, and reads sorter than 10 bases were discarded. An additional round of trimming was performed to remove 5’-RN nucleotides introduced by circularization from the RT primer. Reads were processed with the mim-tRNAseq computational pipeline using the common parameters --snp-tolerance --cluster --min-cov 2000 --max-mismatches 0.1 --cca-analysis --remap --remap-mismatches 0.075 and unique options for --control-condition and --cluster-id (0.90 for budding yeast, 0.95 for fission yeast and Drosophila, and 0.97 for human samples). HEK293T samples were addiitonally aligned to a collapsed non-redundant reference with Bowtie (parameters -m 1 -v3 --best --strata) or Bowtie 2 in local mode (--local -k 100 --very-sensitive --ignore-quals --np 5 --reorder). Genome_build: S288c, 972h, dm6, hg19
|
|
|
Submission date |
Jun 16, 2020 |
Last update date |
Feb 12, 2021 |
Contact name |
Danny Nedialkova |
E-mail(s) |
[email protected]
|
Organization name |
Max Planck Institute for Biochemistry
|
Lab |
Mechanisms of Protein Biogenesis
|
Street address |
Am Klopferspitz 18
|
City |
Planegg |
State/province |
Bayern |
ZIP/Postal code |
82152 |
Country |
Germany |
|
|
Platform ID |
GPL19756 |
Series (1) |
GSE152621 |
High-resolution quantitative profiling of tRNA abundance and modification status in eukaryotes by mim-tRNAseq |
|
Relations |
BioSample |
SAMN15268873 |
SRA |
SRX8557740 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|