GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4588096

Query DataSets for GSM4588096

Status

Public on Jul 10, 2020

Title

SMK-MOCP-1

Sample type

SRA

Source name

Lung tissue

Organism

Mus musculus

Characteristics

strain: B6
tissue: Lung
air exposure: cigarette smoke
lt-beta-r-lg treatment: No
number of cells: 1331

Treatment protocol

Cigarette smoke exposure: Cigarette smoke (CS) was generated from 3R4F Research Cigarettes, with the filters removed. Mice were whole body exposed to active 100% mainstream CS of 500 mg/m3 total particulate matter for 50 min twice per day for 6 months in a manner mimicking natural human smoking habits.
Mice were treated with an LTβR-Ig fusion protein (80 µg i.p., weekly) (muLTβR-muIgG, kindly supplied by Jeffrey Browing, Biogen Idec) or control-Ig (MOPC21, Biogen Idec) for 2m, starting from 4m of CS exposure. Control mice were kept in a filtered air (FA) environment, but exposed to the same stress as CS-exposed animals.

Extracted molecule

total RNA

Extraction protocol

Single cells were diluted in PBS, supplemented with 0.04% bovine serum albumin up to a final concentration of 100 cells/µl. Using a microfluidic PDMS device (Nanoshift), single cells were co-encapsulated in droplets with barcoded beads (Chemgenes Corporation, Wilmington, MA) at a final concentration of 120 beads/uL. Droplets were collected for 15 min/sample. After droplet breakage, beads were harvested, washed, and prepared for on bead mRNA reverse transcription (Maxima RT, Thermo Fisher). Following an exonuclease I (New England Biolabs) treatment for the removal of unused primers, beads were treated with Klenow enzyme to improve single cell transcript quality; thereafter, beads were counted, aliquoted (2000 beads/reaction, equals ~100 cells/reaction), and pre-amplified by 12 PCR cycles (primers, chemistry, and cycle conditions identical to those previously described in Macosko et al., 2015).
PCR products were pooled and purified twice using 0.6x clean-up beads (CleanNA). Prior to tagmentation, cDNA samples were loaded on a DNA High Sensitivity Chip on the 2100 Bioanalyzer (Agilent) to ensure transcript integrity, purity, and amount. For each sample, 1 ng of pre-amplified cDNA from an estimated 1500 cells was tagmented by Nextera XT (Illumina) with a custom P5 primer (Integrated DNA Technologies). Single cell libraries were sequenced in a 100 bp paired-end run on the Illumina HiSeq4000 using 0.2 nM denatured sample and 5% PhiX spike-in. For priming of read 1, 0.5 µM Read1CustSeqB was used (primer sequence: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC).

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 4000

Description

muc14448
Drop-seq

Data processing

For preprocessing of the single cell data of mouse lung tissue cells, the Dropseq computational pipeline was used (version 2.3.0) as previously described (Pubmed ID: 26000488). Briefly, STAR (version 2.5.3a) was used for mapping. Reads were aligned to the mm10 reference genome (GSE63269). For barcode filtering, we excluded barcodes with less than 200 genes detected. A high proportion (> 20%) of transcript counts derived from mitochondria-encoded genes may indicate low cell quality, and we removed these unqualified cells from the downstream analysis.
Genome_build: mm10 (GRCm38)
Supplementary_files_format_and_content: Raw count matrix (LTbetaTreatment_raw_counts.mtx) from Drop-seq experiments with 25095 genes and 21413 cells in market matrix format and corresponding column (LTbetaTreatment_genes.txt) and row (LTbetaTreatment_barcodes.txt) labels. Cell-level metadata (LTbetaTreatment_cells_metadata.txt).

Submission date

Jun 02, 2020

Last update date

Jul 10, 2020

Contact name

Meshal Ansari

Organization name

Boehringer Ingelheim

Street address

Birkendorfer Straße 65

City

Biberach