|
| Status |
Public on May 23, 2021 |
| Title |
sgRNA counts (day 18, venetoclax selection) rep2 |
| Sample type |
SRA |
| |
|
| Source name |
Leukemia cell line (THP1)
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: Paediatric monocytic cell line derived from AML M5 with t(9;11)(q21;q23) translocation
crispr sgrna library: TKOv3
treatment: venetoclax
|
| Treatment protocol |
half the transduced cells were continuously treated with venetoclax for 18 days (6 passages)
|
| Growth protocol |
lentiviral pooled CRISPR screening with lentiCRISPRv2-TKOv3; cells grown in RPMI 1640 + 10% FBS and passaged every 72h
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
QIAamp DNA Blood Maxi Kit (Qiagen)
Sequencing libraries were prepared in two PCR steps, the first to enrich sgRNA regions from the genome, and the second to amplify sgRNA and attach sequencing adapters and indices (based on Aregger, M., Chandrashekhar, M., Tong, A. H. Y., Chan, K. & Moffat, J. in Methods Mol. Biol. 169–188 (2019). doi:10.1007/978-1-4939-8805-1_15)
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Description |
Sequencing of THP1 + Venetoclax sgRNA representation at day 18
T6D_Venetoclax_rep2
|
| Data processing |
Library strategy: amplicon DNA sequencing
Combine and merge Read 1 and 2 using BBMerge (quality score threshold = 30)
Count sgRNA sequences using CRISPRessoCount ("-t GTTTTAGAGCTAGAAATAGC")
MAGeCK-RRA v0.5.7 with CNV normalisation (based on THP-1 gene copy numbers derived from Affymetrix SNP6.0 arrays, downloaded from Cancer Cell Line Encyclopedia) and 10,000 permutations
MAGeCK-Flute v1.3.1 for volcano plots
Genome_build: TKOv3 sgRNA library
Supplementary_files_format_and_content: Normalized sgRNA read counts
|
| |
|
| Submission date |
May 28, 2020 |
| Last update date |
May 23, 2021 |
| Contact name |
Thomas Milne |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Oxford
|
| Department |
Radcliffe Department of Medicine
|
| Lab |
Milne Lab
|
| Street address |
MRC MHU, WIMM, John Radcliffe Hospital
|
| City |
Oxford |
| ZIP/Postal code |
OX3 9DS |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL21697 |
| Series (2) |
| GSE151389 |
A KMT2A-AFF1 gene regulatory network highlights the role of core transcription factors and reveals the regulatory logic of key downstream target genes [CRISPR sgRNA screen] |
| GSE151390 |
A KMT2A-AFF1 gene regulatory network highlights the role of core transcription factors and reveals the regulatory logic of key downstream target genes. |
|
| Relations |
| BioSample |
SAMN15048669 |
| SRA |
SRX8418611 |
